Anti tubulin

Manufactured by Santa Cruz Biotechnology

Sourced in United States, United Kingdom, Germany

Anti-tubulin is a laboratory reagent used for the detection and analysis of tubulin, a structural protein that is a key component of the cytoskeleton in eukaryotic cells. It functions by specifically binding to tubulin, allowing for the visualization and quantification of this protein in various experimental settings.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Anti-β-tubulin (135 citations) Mouse anti-tubulin (26 citations) Rabbit anti-β-tubulin (17 citations) Anti-alpha-tubulin (6 citations) Anti-α-tubulin (B-5-1-2, (5 citations) Anti-α-tubulin (sc-23948, (5 citations) Anti-TUBULIN antibody (SC-23948) (3 citations) Anti-α-tubulin (TU-02) (3 citations) Monoclonal mouse anti-α-Tubulin antibody (sc-23948; (3 citations) Anti-α tubulin monoclonal antibody (sc-5286; (2 citations)

154 protocols using anti tubulin

Protein Extraction and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cells were lysed using 1× buffer (150 mM NaCl, 50 mM Tris-HCl (pH 7.4), 2 mM EDTA, 1.0% Triton X-100, 1.0% sodium deoxycholate, and 0.1% sodium dodecyl sulfate (SDS)), and the protein concentration was detected using a bicinchoninic acid assay kit (BCA kit; CWBiotech). Samples containing 20 μg of total protein were separated on a 10% SDS-polyacrylamide gel by electrophoresis and then transferred onto nitrocellulose membranes (GE Healthcare, Chicago, USA). The membranes were then probed with the primary antibodies, and tubulin was used as an internal control. The following primary antibodies were used for Western blotting: anti-Mcl-1 (1:1000; Cell Signaling, USA) and anti-Tubulin (1:1000, Santa Cruz, USA).

Liu A.S., Yu H.Y., Yang Y.L., Xue F.Y., Chen X., Zhang Y., Zhou Z.Y., Zhang B., Li L., Sun C.Z., Huang P, & Huang J.F. (2019). A Chemotherapy-Driven Increase in Mcl-1 Mediates the Effect of miR-375 on Cisplatin Resistance in Osteosarcoma Cells. OncoTargets and therapy, 12, 11667-11677.

+ Open protocol

+ Expand

Characterizing CRBN-mediated Protein Degradation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were used: anti-FLAG (Sigma, F7425), anti-IKZF3 (Cell Signaling, #15103), anti-IKZF1 (Cell Signaling, #9034), anti-RUNX1 (Abcam, ab92336), anti-RUNX3 (Cell Signaling, #9647), anti-CBFβ (Santa Cruz, sc-20693), anti-CRBN (Sigma, HPA045910), anti-ubiquitin (K48) (EMD Millipore, #05–1307), anti-TUBULIN (Santa Cruz, sc-8035), anti-VINCULIN (Santa Cruz, sc-73614), anti-Rabbit IgG-HRP (GE Healthcare, NA934V), and anti-mouse IgG-HRP (GE Healthcare, NA931V). The following agarose beads were used: anti-FLAG M2 Affinity Gel (Sigma, A2220) and Glutathione Sepharose 4B (GE Healthcare, #17075601). The following in vitro translation kit was used: TNT T7 Coupled Reticulocyte Lysate Systems (Promega, L4610). Benzonase was used according to manufacturer (Sigma, E1014). The following compounds were used: Lenalidomide (Sigma, CDS022536), Pomalidomide (Sigma, P0018), Bortezomib (Millennium Pharmaceuticals), and AI-10–104 was kindly provided by Dr. John H. Bushweller.

Zhou N., Gutierrez-Uzquiza A., Zheng X.Y., Chang R., Vogl D.T., Garfall A.L., Bernabei L., Saraf A., Florens L., Washburn M.P., Illendula A., Bushweller J.H, & Busino L. (2019). RUNX proteins desensitize multiple myeloma to lenalidomide via protecting IKZFs from degradation. Leukemia, 33(8), 2006-2021.

+ Open protocol

+ Expand

Protein Expression Analysis in ALS Mouse Model

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tibialis anterior muscles from normal and G93A mice were collected and homogenized in protein extraction buffer containing protease inhibitor cocktail (Thermo Scientific, Waltham, MA) using motorized homogenizer (Wheaton, Millville, NJ). Protein concentrations were determined by BCA protein assay (Thermo Scientific). Equal mass protein samples (30 μg) were subjected to SDS‐polyacrylamide gel electrophoresis before transferred to nitrocellulose (Bio‐Rad, Hercules, CA), and immunoblotted with primary antibodies. The antibodies used were as follows: anti‐phospho‐mTOR (ser2448) (Cell Signaling, Danvers, MA, 5536), anti‐mTOR (Cell Signaling, 2983), anti‐lysozyme (Santa Cruz, Dallas, TX, sc‐27958), anti‐caspase‐3 (Cell Signaling, 9665), anti‐Beclin 1 (Santa Cruz, sc‐10086), anti‐Bcl‐xl (Santa Cruz, sc‐8392). All these antibodies were used at a 1:1000 dilution. One antibody, anti‐tubulin (Santa Cruz Biotechnology), was used at a 1:10000 dilution. Results were visualized with ECL reagents (Thermo Scientific). Densitometry evaluation was conducted using ImageJ software (NIH, Bethesda, MD).

Xiao Y., Ma C., Yi J., Wu S., Luo G., Xu X., Lin P., Sun J, & Zhou J. (2015). Suppressed autophagy flux in skeletal muscle of an amyotrophic lateral sclerosis mouse model during disease progression. Physiological Reports, 3(1), e12271.

+ Open protocol

+ Expand

Protein Extraction and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

In brief, treated cells were harvested in RIPA buffer (1% Triton X-100, 150mM NaCl, 20mM Hepes (pH 7.5), 10% glycerol, 1mM EDTA, 100mM NaF, 17.5mM β-glycerophosphate, 1mM PMSF, 4µg/ml aprotinin, 2µg/ml pepstatin A), lysates were sonicated and cleared by centrifugation, protein concentrations were quantitated. 25–50 µg were electrophoresed on a reducing Tris-Tricine gel, and electroblotted to PVDF membrane. Antibodies used were anti-β-catenin and anti-Wnt16 (BD Biosciences Pharmingen), anti-p-eIF2#, anti-CHOP (Cell Signaling Technology), anti-LC3 (MBL International), anti-sXbp1 (Biolegend), anti-β-actin (Abcam) and anti-tubulin (Santa Cruz Biotechnology). Primary antibodies were detected with species-specific HRP-secondary antibodies (Invitrogen) and visualized with ECL (Amersham).

Papandreou I., Verras M., McNeil B., Koong A.C, & Denko N.C. (2015). Plant Stilbenes Induce Endoplasmic Reticulum Stress and Their Anti-Cancer Activity can be Enhanced by Inhibitors of Autophagy. Experimental cell research, 339(1), 147-153.

+ Open protocol

+ Expand

Antibody-based Protein Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies used in this study included: anti-PUMA (Cell Signaling Technology); anti-cleaved poly ADP-ribose polymerase (PARP; Cell Signaling Technology); anti–β-actin (Sigma); anti-ATM (Abcam); anti-p-Ser1981-ATM (Abcam); anti-cleaved Caspase 7 (Stressgen Bioreagents Corp.); anti-p-Ser15-p53 (Cell Signaling Technology); anti-p53 (Oncogene Research); anti-Cdk2 (Santa Cruz Biotechnology); anti-Ku86 (Santa Cruz Biotechnology); anti-Tubulin (Santa Cruz Biotechnology); and anti-Flag (Sigma). 5-FU and MTX were purchased from Sigma. 2-¹⁴C-5-FU was purchased from Moravek Biochemicals. Cks expressing adenoviruses were described previously (13 (link)).

del Rincón S.V., Widschwendter M., Sun D., Ekholm-Reed S., Tat J., Teixeira L.K., Ellederova Z., Grolieres E., Reed S.I, & Spruck C. (2014). Cks Overexpression Enhances Chemotherapeutic Efficacy by Overriding DNA Damage Checkpoints. Oncogene, 34(15), 1961-1967.

+ Open protocol

+ Expand

Neutrophil Signaling Pathway Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The N-fMLP peptide was synthesized and HPLC-purified by PRIMM (Milan, Italy). SDS-PAGE reagents were purchased from Bio-Rad (Hercules, CA, USA). Protein A/G Plus, anti-Flk1, anti-p-Flk1 (Tyr951), anti-p-Flk1 (Tyr996), anti-p-Flk1 (Tyr1175), anti-p-Flk1 (Tyr1214), anti-p-Tyr, anti-p47^phox, anti-p22^phox, anti-p-PLCγ1 (Y783), anti-PLCγ1, anti-PKCα, anti-PKCβII, anti-PKCζ, anti-PKCδ, anti-tubulin, anti-mouse, and anti-rabbit were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-p-PI3K (p85) and anti-p-Akt (Ser473) were from Cell Signaling Technology (Danvers, MA, USA). Anti-p-Ser, p22^phox siRNA (SI03078523), and scramble control siRNA (SI03650318) were from Qiagen (Hiden, Germany). FPR1 siRNA (L-005140-00) and scramble control (D-001810-10) were purchased from Dharmacon (Lafayette, CO, USA). Protein A-horseradish peroxidase was from Amersham Pharmacia Biotech (Little Chalfont, Buckinghamshire, UK). Pertussis toxin (PTX), apocynin, wortmannin, and LY294002 were from Sigma (St. Louis, MO, USA).

Cattaneo F., Castaldo M., Parisi M., Faraonio R., Esposito G, & Ammendola R. (2018). Formyl Peptide Receptor 1 Modulates Endothelial Cell Functions by NADPH Oxidase-Dependent VEGFR2 Transactivation. Oxidative Medicine and Cellular Longevity, 2018, 2609847.

+ Open protocol

+ Expand

Liver Protein Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were anesthetized and sacrificed after fasting for 20–24 h. Livers were isolated and homogenized in a lysis buffer (50 mM Tris HCl, pH 7.5, 1% TRITON-X 100, 150 mM NaCl, 2 mM EGTA, 100 mM NaF, 1 mM PMSF, 10 μg/ml aprotinin and 10 μg/ml leupeptin). The extracts from the liver, primary hepatocytes or HEK293T cells were immunoblotted with anti-APOA4 (Cell Signaling), anti-tubulin (Santa Cruz), anti-HuR and anti-albumin (Proteintech Group, Inc.) or anti-actin (BD Transduction Laboratories™).

Qin W., Li X., Xie L., Li S., Liu J., Jia L., Dong X., Ren X., Xiao J., Yang C., Zhou Y, & Chen Z. (2016). A long non-coding RNA, APOA4-AS, regulates APOA4 expression depending on HuR in mice. Nucleic Acids Research, 44(13), 6423-6433.

+ Open protocol

+ Expand

Western Blotting Analyses of PI3K Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blotting analyses were performed using the following antibodies: anti PI3K-C2α, anti PI3K-C2β (BD Transduction Laboratories); anti p110β, anti p110α, anti pERK1-2 (Thr202-Tyr204), anti pMEK1-2 (Ser217-221), anti PTEN, anti TCF8/ZEB1, anti ZO-1, anti β catenin, anti Vimentin, anti Claudin-1, anti Slug (Cell Signaling Technology); anti Tubulin, anti ERK2, anti Actin (Santa Cruz Biotechnology); anti GAPDH (Abcam); anti-rabbit IgG, anti-mouse IgG (Sigma Aldrich, UK). Transient downregulation of enzymes of interest was obtained using the following siRNAs: PI3K-C2β (sequence 1): AAGAATGCGACGCCTGGCAAG (Qiagen); PI3K-C2β (sequence 2): Cat. No. J-006772-08 (Dharmacon); p110β (Dharmacon, smartpoolA); Slug: Cat. No. J-017386-05 (Dharmacon). Non-targeting siRNAs (Ambion or Dharmacon), designated as ‘si NC’, were used as control.

Mavrommati I., Cisse O., Falasca M, & Maffucci T. (2016). Novel roles for class II Phosphoinositide 3-Kinase C2β in signalling pathways involved in prostate cancer cell invasion. Scientific Reports, 6, 23277.

+ Open protocol

+ Expand

Western Blot Antibody Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

For western blotting, the following antibodies were used: anti-GFP, anti-tubulin, anti-Ub, anti-E2-25K, anti-synaptophysin antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA); anti-caspase-3, anti-S5a antibodies (Cell Signaling, Beverly, MA, USA); anti-SUMO1, anti-NSE antibodies (Zymed, Carlsbad, CA, USA); anti-S10 antibody (Genetex, Irvine, CA, USA); anti-S5b antibody (Novus, Littleton, CO, USA); anti-S5a, anti-S7, anti-PAC2, anti-β5, anti-20S core antibodies (Biomol, Farmingdale, NY, USA); anti-S2 antibody (Abcam, Cambridge, UK); anti-p27 antibody (Sigma-Aldrich, St. Louis, MO, USA); and anti-S6a antibody (Enzo, Plymouth Meeting, MA, USA). Anti-E2-25K antibody was described previously.^{28 (link)}

Jeong E.I., Chung H.W., Lee W.J., Kim S.H., Kim H., Choi S.G, & Jung Y.K. (2016). E2-25K SUMOylation inhibits proteasome for cell death during cerebral ischemia/reperfusion. Cell Death & Disease, 7(12), e2573-.

+ Open protocol

+ Expand

Antibody-based Detection of 11β-HSD1 and 11β-HSD2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies against residues 261–405 of human 11β-HSD2 (clone H-145), and amino acids 65–164 of 11β-HSD1 (clone H-100), anti-tubulin, horseradish peroxidase-conjugated and FITC-conjugated anti-rabbit IgGs and 18β-glycyrrhetinic acid (18β-GA) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Nitrocellulose membranes, keratinocyte growth medium and antibiotics/anti-mycotics were obtained from Invitrogen (Paisley, UK). Reagents for enhanced chemiluminescence and films were obtained from Amersham Biosciences (Buckinghamshire, UK) and the reagents for protein extraction and cell culture were obtained from Sigma (Sigma-Aldrich, Gillingham, Dorset, UK).

Cirillo N., Morgan D.J., Pedicillo M.C., Celentano A., Lo Muzio L., McCullough M.J, & Prime S.S. (2017). Characterisation of the cancer-associated glucocorticoid system: key role of 11β-hydroxysteroid dehydrogenase type 2. British Journal of Cancer, 117(7), 984-993.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!