Generacer kit

Total RNA was isolated from human colon cancer (DLD-1) and prostate cancer (PC-3) cells with the RNeasy Mini-Kit (Qiagen). Using the GeneRacer Kit (Thermofisher), the RNAs were prepared stepwise to allow detection of their 5′ ends by fusing a specific 5′GeneRacer Oligo to the mRNAs and reverse transcribe them into cDNAs with SuperScript III Reverse Transcriptase and Random Primers (provided by the GeneRacer Kit). RACE-ready (Rapid Amplification of cDNA Ends) cDNA is processed in PCR by using the GeneRacer 5′Primer and a reverse primer specific for Gal-8 (hGal8-GSP-RACE-5; GCTTGGGTACTTTGTAAGTCCGAGCTGA), following a nested-PCR with GeneRacer-nested 5′ Primer and hGal8-GSP-RACE-4 (CCTGGAATCTGTCTGCGTCACTAGGAACA). The resulting fragments were cloned into the TOPO-vector pCR4 (Thermofisher), to followed by transformation of cells of the E. coli strain TOP10. Plasmids were later purified using a commercial plasmid kit (Stratec Biomedical) and then sequenced (GATC).

To validate the predicted miRNA-induced cleavage site, a modified RNA ligase-mediated 5′ Rapid Amplification of cDNA ends was used as described in [80 (link)]. From 5 µg of total RNA, the 5′RACE protocol was performed using the GeneRacer kit (Invitrogen Life Technologies, Waltham, MA, USA), according to the supplier’s instructions except for the first two steps (decapping and phosphorylation), which are specific of intact transcripts.
In order to maximise amplification specificity, two successive rounds of PCR amplification (nested PCR) were performed using the Phusion High-Fidelity DNA Polymerase with HF buffer (ThermoScientific), primers provided in the GeneRacer kit (GeneRacer 5′ primer and GeneRacer nested 5′ primer in the first and second round, respectively) as forward primers and gene-specific primers (MYB65-GSP and MYB65-nested-GSP) targeting MYB mRNA as reverse primers.
Primer design of the MYB65-GSP and MYB65-nested-GSP primers was performed downsteam of the predicted cleavage site using the Primer3Plus tool (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi; 25 September 2021) [77 (link)] with the following parameters complying with the recommendations of the GeneRacer kit: amplicon size 70–150 pb, primer length 23–28 nucleotides, primer melting temperature (Tm) 60–74 °C. The sequences of the resulting primers are shown in the Table S5.

RNA ligase-mediated rapid amplification of cDNA ends (5′ RACE) was performed using Gene Racer Kit (Invitrogen, CA, USA) A with few modification [20 (link)]. Large-scale total RNA was extracted from different developmental stages of fruit and flower using a hot phenol method [107 ] and treated with RNAase-free DNAase (RNeasy Mini Kit, Qiagen Sciences, MD, USA). The total RNA concentration was quantified using ND-1000 v3.1.0 (NanoDrop Technologies, Wilmington, DE). Poly (A)⁺ mRNA was extracted by an Oligotex mRNA Midi Kit (Qiagen, CA, USA) from 500 μM of total RNA.
Ligation of RNA adapter, reverse transcription, and 5′-RACE PCR were carried out according to the manufacturer’s instruction (Gene Racer Kit, Invitrogen) with 100 nM poly(A)⁺ mRNA. Non-gene specific 5′-RACE products were generated by amplification with the Gene Racer 5′ Primer (5′-CGACTGGAGCACGAGGACACTGA-3′) and Gene Racer 3′ Primer (5′-GCTGTCAACGATACGCTACGTAACG-3′). Gene-specific 5′-RACE reactions were conducted with the Gene Racer 5′ Nested Primer and gene-specific primers as follows: PCR products were gel-purified, cloned into a plasmid vector using the TA TOPO PCR Cloning Kit (Invitrogen), and sequenced using the Illumina platform.