Qtower3g

The expression levels of three functional genes associated with key metabolites were detected by real-time quantitative PCR (RT-qPCR). Total RNAs of the bacteria were extracted using the Trizol reagent (Life Technologies, Carlsbad, CA, USA). The cDNA was synthesized using PrimeScript™RT reagent Kit with gDNA Eraser (Takara, Japan). A ChamQ^TM Universal SYBR^® qPCR Master Mix (Vazyme, China) was used for qPCR sample detection. The qPCR instrument was a qTOWER3G (Analytikjena, Germany). The PCR conditions were as follows: 95 °C (initial activation temperature) for 3 min, then 95 °C (denaturation temperature) for 5 s, 60 °C (annealing temperature) for 5 s, and 72 °C (extension temperature) for 15 s by 40 cycles. All RT-qPCR experiments were repeated at least three times. All data were determined by the 2^−ΔΔCt method [13 (link)] and normalized to the 16S rRNA reference gene in each sample. The primer sequences for qPCR were as follows: ydfG (F: CGTGAAGGCATCACCGTCCATG; R: TGTCCAGACCTTCGACCACCTG), rutE (F: CGAACTGGGAGCGTTACCTGAAC; R: GCTGCAAAGGTGGTCTTGGAAATG), PP-0596 (F: GCACCAGGAACGTCGTCGATATC; R: GCCACCGAAGCGTACATAGAAGC), 16S rRNA (F: GAACGCTAATACCGCATACGTCC; R: ATCATCCTCTCAGACCAGTTAC).

qRT-PCR was conducted to measure changes in stress-related gene expression by using qTOWER³ G (Analytik Jena, Jena, Germany). PCR amplification procedures was set as following: 95 °C for 30 s, followed by 40 cycles at 95 °C for 20 s, 56 °C for 60 s, and a melt cycle from 65 to 95 °C. All primer sequences are listed in Supplementary Table S6 and the loquat qEjActin gene and Arabidopsis AtActin gene were used as internal controls. PCRs were performed in 10-μL volumes using NovoStart ^®SYBR qPCR SuperMix Plus (Novoprotein, Shanghai, China) with each primer at a concentration of 0.05 μM. The 2^−∆∆Ct method [53 (link)] was used to calculated the relative expression values.

Based on the instructions of the RNAiso reagent (TaKaRa Biotechnology, Dalian, China), total RNA was isolated from the tissues and cells. All samples were quantified by using Nanodrop One (Thermo Fisher Scientific Inc., MA, United States). Primers were synthesized by Tsingke (Beijing, China). Total RNA (20 ng) was subjected to reverse transcription and then used for performing real-time PCR using a qRT-PCR Kit, according to the manufacturer’s instructions (TaKaRa Biotechnology). And qTOWER 3G (Analytik jena, jena, German) was used to determine the expression level of LINC01614. The relative expression of the target gene was quantified using the 2^−ΔΔCt method; β-actin was used as the internal reference. The primer sequences are shown in Supplementary Table S1.

The cells transfected with plasmids or bacmids were harvested, and total RNA was prepared using the Total RNA Kit II (OMEGA, Norcross, GA, USA) and reverse transcribed into complementary DNA using PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Beijing, China). qRT-PCR was conducted in a 10 μL reaction mixture with NovoStart SYBR qPCR SuperMix Plus (Novoprotein, Shanghai, China), and each test was performed thrice. The reaction conditions were 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and 60 °C for 30 s. Primers of the house-keeping gene, silkworm translation initiation factor 4A (sw22934), were used to normalize the gene expression. Sample analysis was performed on the qTOWER3G (Analytik Jena AG, Jena, Germany).
Total DNA was extracted using a Wizard Genomic DNA extraction kit (Promega, Madison, WI, USA). The gp41 viral gene was used to quantify viral DNA abundance. qRT-PCR was performed as previously described. All primers used for qRT-PCR are listed in Supplementary Table S4.

The total rice RNA was extracted from the roots, stems, leaves, sheaths, and young panicles with an RNA isolater kit (Vazyme), and the first-strand cDNA was reverse transcribed using a reverse transcription kit (Vazyme). The quantitative real time RT-PCR (qRT-PCR) analysis was conducted with a real-time PCR system (qTOWER³ G, analytikjena, Jena, Germany). The Actin 1 gene was chosen as a reference gene. Three biological replicates were carried out in each experiment, and Student’s t test was used for the statistical analysis. All of the primers used in the qRT-PCR analysis are listed in Table S2 [55 (link),56 (link),57 (link),58 (link)].

RAW264.7 macrophages (1 × 10⁶ cells/well) were cultured in 6-well plates with 24 h incubation, CE with various concentrations (0–100 μg/mL) were added in each well (except control group) for 2 h of pretreatment, and 1 μg/mL LPS was subsequently added for 6 h incubation. Then, total RNA was extracted by using the TransZol Up RNA extraction kit (Transgen Biotech, Beijing, China). The purities and concentrations of RNA were measured using a UV spectrophotometer (Biochrom, UK) with the absorbance 260/280 nm. PrimeScript^TM RT reagent kit with gDNA eraser (Takara, Dalian, China) was used to remove genomic DNA and reverse transcribe 1 μg total RNA to cDNA. The target genes expressions were observed intuitively by the semiquantitative RT-PCR method. Agarose gel stained by GelStain (1%, Transgen Biotech, Beijing, China) was used to analyze the PCR products. In addition, quantitative PCR was performed in 20 μL reaction volumes by qTOWER3G (Analytik Jena, Germany) to further quantify the expression levels of mRNA. The cycling procedure was 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. The expressions of relative genes were analyzed according to the 2^−ΔΔCt method. The primer sequences are given in Table 1, and GAPDH was considered as an internal reference.

Total RNA was extracted from the calli, embryos, and a mixture of calli and embryos according to the manufacturer’s instructions of Takara RNAiso Plus (Takara Biotechnology, Dalian, China). The RNA quality was examined by gel electrophoresis, and the concentration was quantified using Infinite^® 200 PRO (Tecan, Mannedorf, Switzerland). The cDNA was synthesized with a Vazyme HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper). RT PCR was performed using the qTOWER³ G (Analytik Jena, Jena, Germany) in a 20 μL reaction containing 0.4 μL 10 μmol/L specific primers, 1 μL cDNA template, 8.2 μL ddH₂O, and 10 μL Vazyme ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). The RT PCR conditions were 95 °C for 30 s, followed by 40 repeated cycles of 95 °C for 10 s and 60 °C for 30 s. A melting curve was performed for each sample to confirm the specificity of the reactions. All RT PCR analyses were performed three times for each sample. The relative expression levels of each gene were normalized to the CT values of the Hevea reference gene HbRh2b (HQ323243) and calculated using the 2^−ΔCT method [49 (link)]. The primers used in the experiment are listed in Supplementary Table S3.