Abi prism 7000 sds software

Quantitative real-time RT-PCR was performed with SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) using an ABI PRISM 7000 Sequence Detection System (Applied Biosystems). The amplification data were analyzed with ABI PRISM 7000 SDS software (Applied Biosystems), converted into cycle numbers at a set cycle threshold (Ct values) and quantified relative to a standard. HSQ-89 RNA was used as a standard in all experiments. To normalize the amounts of input cDNA, the relative amount of the generated product was divided by the relative amount of β-actin. All samples were analyzed in duplicate. The primers used are as follows: TFRC forward, 5′-CATCAGCCTCCTGGTTATGG-3′, reverse, 5′-AAATGCCTCCGCTTATGTTG-3′; and β-actin forward, 5′-GACAGGATGCAGAAGGAGATTACT-3′ and reverse, 5′-TGATCCACATCTGCTGGAAGGT-3′.

RNA was isolated from snap frozen tissues using the RNeasy kit (Qiagen, Limburg, Netherlands), RNA was treated on column with RNase-free DNase (Qiagen) and an additional DNase treatment was performed on the RNA using Ambion DNA-free DNase Treatment and Removal according to the manufacturers' protocols. The RNA was retrotranscribed using the SuperScript VILO cDNA Synthesis Kit (Invitrogen, Life Technologies, Grand Island, NY). Relative qPCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies). The ViiA7 Real-Time PCR machine (Applied Biosystems) was used for carrying out the reaction. Cycling conditions: 95°C 10 mins, 40 × (95°C 15 sec, 60°C 1 min). Dissociation curves were generated to verify absence of unspecific amplification. Data were analyzed using the ABI Prism 7000 SDS Software (Applied Biosystems). GAPDH was used as endogenous control for sample normalization. All primers were tested for efficiency and compared to the efficiency of the GAPDH reaction. Primers are listed in Table S1. The fold increase in gene expression was measured on one animal chosen as reference and the data were plotted as fold increase on the average of the control animals.

TRIzol reagent (Invitrogen) was used for isolating total RNA from SV40 MES-13 cells at different groups according to manufacturer’s instructions [23 (link)]. Then, SuperScript™ IV One-Step RT-PCR System (catalog number: 12594025, Invitrogen) was used for the preparation of cDNA. QuantStudio®3 Quantitative real-time PCR instrument (Applied Biosystems) was used to perform qRT-PCR reactions. A total fluid volume of 25 μl and TaqMan™ Fast Advanced Master Mix (catalog number: 4444556, Applied Biosystems) were used for the amplification. A two-step cycle protocol was used for detecting GAS5 expression. ABI Prism 7000 SDS software (Applied Biosystems) was used for analyzing the data. The relative expression of GAS5 was calculated by comparative method 2^−ΔΔC_t.

Non-stimulated or stimulated B cells were harvested as indicated in the figure legends. Total cellular RNA was isolated using the GenElute Mammalian Total RNA Miniprep Kit (Sigma). For cDNA synthesis, 2 µg of total RNA was used. RT-PCR was carried out using TaqMan Master Mix and 20× TaqMan Gene Expression Assays [Dock8: Mm00472344_m1, Dock10: Mm00614273_m1, Dock11: Mm01297590_m1, GAPDH: Mm03302249_m1, and Mb-1 (CD79a): Mm00432423_m1, Applied Biosystems]. Samples were run in Thermo Fast 96 PCR plates (96-well ABgene PCR plates, Thermo Scientific) with the ABI PRISM 7000 Sequence Detection System (Applied Biosystems), using an absolute quantification in ABI PRISM 7000 SDS Software. The results from primary activated B cells were normalized to Mb-1 and non-stimulated B cells; those of cell lines were normalized to GAPDH and 70Z/3. The degree of increase or decrease was calculated based on the amplification efficiency for each gene. The degree of induction by IL-4 for cell lines was normalized to non-stimulated cell lines and the degree of increase was calculated using the amplification efficiency of Dock10.

We aimed to confirm the lack of Kiss1 expression in the POA and MBH of Kiss1 KO mice. WT (OVX; n = 3) and Kiss1 KO (n = 5) female mice were killed, brains were exposed and the POA and MBH was extracted and immediately frozen in dry ice and stored at −80 C. Total RNA from both areas was isolated using TRIzol reagent (Invitrogen) followed by chloroform/isopropanol extraction. RNA was quantified using NanoDrop 2000 spectrophotometer (Thermo Scientific) and one microgram of RNA was reverse transcribed using Superscript III cDNA synthesis kit (Invitrogen). Quantitative real-time PCR assays were performed in triplicates of each sample on an ABI Prism 7000 sequence detection system, and analyzed using ABI Prism 7000 SDS software (Applied Biosystems). The cycling conditions were as follows: 2 min incubation at 50°C, 10 min incubation at 95°C (hot start), 40 amplification cycles (95°C for 15 s, 60°C for 1 min, and 45 s at 75°C, with fluorescence detection at the end of cycles 3–40), followed by melting curve of the amplified products obtained by ramped increase of the temperature from 55°C to 95°C to confirm the presence of single amplification product per reaction. The data were normalized using L19 primers as an internal control. Kiss1 expression was detected using primers: F- CTCTGTGTCGCCACCTATGC R – TTCCCAGGCATTAACGAGTTC. Values were normalized with housekeeping gene Rpl19.

Real-time quantitative reverse transcription-PCR (qRT-PCR) was done with the ABI 7000 Sequence Detector (Applied Biosystems). We used ready-made TaqMan® assays on the analyzed genes and custom-designed GAPDH primers and TaqMan® probe [52 (link)] (Applied Biosystems). Reactions for qRT-PCR were done with the TaqMan® universal PCR Master Mix kit (Applied Biosystems) in 96-well plates. Each sample was measured in triplicate. PCR was run using the following conditions: an initial denaturation step of 95 °C for 10 min followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. The resulting data were analyzed with ABI Prism 7000 SDS software (Applied Biosystems). The threshold cycles (CT) were determined, and the differences in the CT values for GAPDH and selected genes were calculated.