Superscript 2 cdna synthesis kit

Total RNA was extracted from each sample and purified using the Norgen Total RNA isolation kit and quantified using a NanoDrop Spectrophotometer ND-100 and quality control was assessed with bioanalyzer total RNA Nano kit. One μg of mRNA was fragmented to an average length of 200 bp by incubation for 5 min at 94 ^oC with 5X fragmentation buffer (Illumina, RS-100-0801). Efficiency of the fragmentation was defined on Bioanalyzer RNA Pico Chip. The fragmented mRNA was randomly primed and reversed transcribed using Super Script II cDNA synthesis kit (Invitrogen, 18064-014). After second-strand synthesis, the cDNA underwent end-repair and ligation reactions according to the Illumina mRNA-Seq Sample Prep Kit protocol. The cDNA library was size-fractioned on a 2% TBE agarose gel. Material in the 350–400 bp range was excised and purified (Zymo Research, D4001). Half of the eluted cDNA library was used as a template for amplification according to mRNA-Seq Sample Prep Kit protocol. The PCR product was purified using PureLink PCR micro purification kit (Invitrogen, Q32850). The library was then used to build clusters on the Illumina flow cell and analysis was done using Illumina Hiseq 2000 platform (Illumina, San Diego, CA, USA) at McMaster University to a target depth of 6 M reads per sample.

Total RNA was extracted using the TRIzol reagent (Invitrogen, USA), according to the manufacturer’s protocol. Using a spectrophotometer (Eppendorf, Germany), the RNA concentration and purity were determined by A₂₆₀ and A₂₆₀/A₂₈₀ ratios, respectively. Total RNA was used to synthesize cDNA with a Super-Script II cDNA synthesis kit (Invitrogen Life Technologies, USA). The related genes of the Wnt/β-catenin signaling pathway and Nanog were assessed by quantitative real-time PCR using a SYBR-Green Master mix (Fermentas, Vilnius, Lithuania). Glyceraldehyde phosphate dehydrogenase (GAPDH) was selected as an internal control. The primer sequences are: Nanog (accession no. NM_001100781) forward, CCGTTGGGCTGACATGAGCGT and reverse, GGCAGGCATCGGCGAGGAAT; β-catenin (accession no. NM_053357) forward, AGCCCGTTGTACCGCTGGGA and reverse, CGCTGGGATGCCGCCAGATT; c-myc (accession no. NM_012603) forward, CATCATCCAGGACTGTATGTG and reverse, TGGAATCGGACGAGGTA; GAPDH (accession no. NM_017008) forward, TATGACTCTACCCACGGCAAGT and reverse, ATACTCAGCACCAGCATCACC.

Total RNA was extracted using ISOGEN II (Wako) according to the manufacturer's instructions. For qRT-PCR analysis, cDNAs were synthesized using a SuperScript II cDNA synthesis kit (Invitrogen). Real-time PCR amplifications were performed in 96-well optical reaction plates with Power SYBR Green PCR Master Mix (Applied Biosystems). The relative expression values of each gene were determined by normalization to GAPDH expression for each sample. Primer sequences: p53-Fw (5′-TCAACAAGATGTTTTGCCAACTG-3′), p53-Rv (5′-ATGTGCTGTGACTGCTTGTAGATG-3′), p21-Fw (5′-TCAGGGTCGAAAACGGCG-3′), p21-Rv (5′-AAGATCAGCCGGCGTTTGGA-3′), Fbxo22-Fw (5′-CTCACTGAAGTAGGTCTTTTAG-3′), Fbxo22-Rv (5′-CCAGCCAAGATGATATTCATATC-3′), Hdm2-Fw (5′-ACCTCACAGATTCCAGCTTCG-3′), Hdm2-Rv (5′-TTTCATAGTATAAGTGTCTTTTT-3′), GAPDH-Fw (5′-GAGTCAACGGATTTGGTC GT-3′), GAPDH-Rv (5′-TTGATTTTGGAGGGATCTCG-3′), IL-6-Fw (5′-CCAGGAGCCCAGCTATGAAC-3′), IL-6-Rv (5′-CCCAGGGAGAAGGCAACTG-3′), IL-8-Fw (5′-AAGGAAAACTGGGTGCAGAG-3′), IL-8-Rv (5′-ATTGCATCTGGCAACCCTAC-3′)