Sybr green pcr kit

Total RNA was extracted using TRIzol reagent (Invitrogen Life Technologies, Waltham, MA, USA), and 1 μg of RNA was used for the reverse transcription reaction with TOPscript RT DryMIX (Enzynomics, Daejeon, South Korea). Quantification of mRNA was determined using a SYBR Green PCR kit (Enzynomics). Relative expression levels of the indicated genes were compared with GAPDH expression using the 2−^ΔΔct method 17. PCR was performed using the following primers: for HDAC1, sense, 5′‐ACGAGTCCTATGAGGCCATTT‐3′, and antisense, 5′‐CACTTGGCGTGTCCTTTGATA‐3′; for HDAC2, sense, 5′‐CATAAAGCCACTGCCGAAGAA‐3′, and antisense, 5′‐TCCATCAAACGCTGGACAATC‐3′; for HDAC3, sense, 5′‐GGTGTCCTTCCACAAATACGG‐3′, and antisense, 5′‐GGCTGGAAAAGGTGCTTGTAA‐3′; for HDAC8, sense, 5′‐AGTGGGAATTGGCAAGTGTC‐3′, and antisense, 5′‐CCAGCACATAATCAGGACCA‐3′; for GAPDH, sense, 5′‐GAAGGTGAAGGTCGGAGTCA‐3′, and antisense, 5′‐GACAAGCTTCCCGTTCTCAG‐3′.

Total RNA from aortic tissue was isolated with TRIzol reagent (Invitrogen Life Technologies), and 1 μg of RNA was used for the reverse transcription reaction with TOPscript RT DryMIX (Enzynomics, South Korea). Quantification of mRNA levels was performed with the SYBR Green PCR kit (Enzynomics, South Korea). The PCR primers used in this study are shown in Table S1.

Total RNA from heart tissue was isolated with TRIzol reagent (Invitrogen Life Technologies), and 1 μg of RNA was used for the reverse transcription reaction with TOPscript RT DryMIX (Enzynomics, South Korea). Quantification of mRNA levels was done with the SYBR Green PCR kit (Enzynomics, South Korea). The PCR primers used in this study are shown in Supplementary Table 1.

Total RNA was isolated from heart tissue with TRIzol reagent (Invitrogen/Life Technologies, Carlsbad, CA, USA), and 1 μg was reverse transcribed with TOPscript RT DryMIX (Enzynomics, Daejeon, South Korea). mRNA levels were then quantified using a SYBR Green PCR kit (Enzynomics). The PCR primers used in this study are given in Table 1.

Total RNA was isolated from heart tissues with TRIzol reagent (Invitrogen/Life Technologies, Carlsbad, CA, United States) and 1 μg was reverse transcribed with TOPscript RT DryMIX (Enzynomics, Daejeon, South Korea). mRNA levels were then quantified using a SYBR Green PCR kit (Enzynomics) using the 2^−∆∆Ct method. The PCR primers used in this study are listed in Table 1.

Total RNA was extracted from the cardiac tissues using TRIzol reagent (Invitrogen), according to the manufacturer's instructions. To quantify the RNA concentration, the absorbance of the sample was measured at 260 nm using an ACTGene spectrophotometer (ASP‐2680). The isolated RNA was reverse transcribed into complementary DNA (cDNA) using TOPscript RT DryMIX (Enzynomics). The SYBR green PCR kit (Enzynomics) and specific primers were used to conduct qRT‐PCR analysis. The relative mRNA levels were calculated using the 2^−ΔΔCt method. The primers used in the qRT‐PCR analysis are shown in Table 1.

Total RNA was extracted from the cardiac tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The isolated RNA (1 μg) was reverse‐transcribed into complementary DNA (cDNA) using TOPscript RT DryMIX (Enzynomics, Daejeon, South Korea). The PCR primers used in this study are shown in Table 1. qRT‐PCR analysis was performed using a 7500 Real‐Time PCR system with the SYBR Green PCR kit (Enzynomics). The expression levels of the target gene were normalized to those of Gapdh (housekeeping gene).