Ncbi blast software

Total RNA was obtained, and reverse transcription was performed as previously described.³⁰ cDNA synthesis was performed with RevertAid First Strand cDNA synthesis Kit (Thermo Scientific) following manufacturer's protocol in an iCycler thermal cycler (Biorad). Real‐time PCR was performed with Fast SYBR Green Master kit (Thermo Scientific) in a 7500 Fast Real‐Time PCR instrument (Applied Biosystems). The PCR conditions were performed as previously described.³⁰ Primers were designed by using the NCBI BLAST software and purchased from Sigma‐Aldrich. Primers sequences used are as follows: ERK5 forward 5′‐AGCACTTTAAACACGACAAC‐3′; ERK5 reverse 5′‐ TAGACAGATTTGAATTCGCC‐3; GAPDH forward 5′‐TCGTGGAAGGACTCATGACCA‐3′; GAPDH reverse 5′‐CAGTCTTCTGGGTGGCAGTGA‐3′.

Total RNA from cell and mice tumor samples (after tissue homogenization with a Polytron) was obtained as previously described [28 (link)]. For samples embedded in paraffin, total RNA was isolated using the Roche High Pure FFPET RNA Isolation Kit (06650775001, (Merck Madrid, Spain) following the manufacturer’s protocol. cDNA synthesis and PCR conditions were performed as previously described [28 (link)]. Primers were designed by using the NCBI BLAST software and purchased from Sigma-Aldrich. The primers used are listed in Supplementary Table S2.