Cd 1 nu nu mice

Manufactured by Charles River Laboratories

Sourced in Germany, United Kingdom, United States

The CD-1 nu/nu mouse is an athymic, hairless mouse model. It is commonly used in research due to its lack of T cells, which makes it useful for the study of human tumor xenografts and the evaluation of therapeutic agents.

Automatically generated - may contain errors

Lab products found in correlation

Tamoxifen, by Merck Group (2 mentions) Wild type c57bl 6 mice, by Charles River Laboratories (2 mentions) Matrigel, by BD (2 mentions) Math1 creert2 mice, by Jackson ImmunoResearch (1 mentions) Estrogen pellet, by Innovative Research (1 mentions) C57bl 6 mice, by Jackson ImmunoResearch (1 mentions) Nod scid il2rgammanull nsg mice, by Jackson ImmunoResearch (1 mentions) Stereotactic head holder, by Kopf Instruments (1 mentions) C57bl 6, by Charles River Laboratories (1 mentions) Scid mice, by Taconic Biosciences (1 mentions) Cisplatin, by MedChemExpress (1 mentions)

48 protocols using cd 1 nu nu mice

Subcutaneous Xenograft Tumor Model

Check if the same lab product or an alternative is used in the 5 most similar protocols

All animal experiments described were approved by the Government of the State of North Rhine-Westphalia (Permit No. 8.87-50.10.37.09.264). Mice were maintained according to the guidelines of the Federation of European Laboratory Animal Science Associations.
To generate subcutaneous xenografts, ACHN YAP knockdown and ACHN mock-transfected cells in log growth phase were harvested by trypsinization, counted, and subsequently injected into the flanks of five male athymic CD1^nu/nu mice (Charles River, Wilmington, MA) as previously described [16] (link). In brief, 2.5 × 10⁶ cells suspended in a total volume of 250 μl [full growth medium/Matrigel (BD Biosciences), 1:1 (vol/vol), prechilled to 4°C] were subcutaneously injected into the flanks of 6- to 8-week-old mice. Starting 10 days after the injection of tumor cells, tumor dimensions were determined twice a week by use of digital calipers (Milomex, Pulloxhill, United Kingdom), and tumor volumes (V) were determined as V = 1/2(ab²), with a being the longest and b the shortest orthogonal tumor diameter. Mice were sacrificed after 6 weeks, and tumors were harvested and cryopreserved or formalin-fixed for later analysis.

Schütte U., Bisht S., Heukamp L.C., Kebschull M., Florin A., Haarmann J., Hoffmann P., Bendas G., Buettner R., Brossart P, & Feldmann G. (2014). Hippo Signaling Mediates Proliferation, Invasiveness, and Metastatic Potential of Clear Cell Renal Cell Carcinoma. Translational Oncology, 7(2), 309-321.

+ Open protocol

+ Expand

Genetically Modified Mouse Models for Colorectal Cancer

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

12.4KbVilCre transgenic mice [25 (link)] and Ncor1^fx/fx [8 (link)] were used to produce Apc^Min/+; Ncor1^+/+(control), Apc^Min/+; 12.4KbVilCre/Ncor1^fx/+ (heterozygotes; Ncor1^DIEC/+), and Apc^Min/+; 12.4KbVilCre/Ncor1^fx/fx (Ncor1^DIEC) mice on a pure C57BL/6J background. Polyp counts were determined as previously described [26 (link)] in accordance with the Institutional Animal Research Review Committee of the University of Sherbrooke (approval ID number 342-17). CD1 nu/nu mice were purchased from Charles River Laboratory and xenograft experiments were approved by the Institutional Animal Research Review Committee of the University of Sherbrooke (approval ID number 276-15B).

St-Jean S., De Castro A.C., Lecours M., Jones C., Rivard N., Rodier F., Perreault N, & Boudreau F. (2021). NCOR1 Sustains Colorectal Cancer Cell Growth and Protects against Cellular Senescence. Cancers, 13(17), 4414.

+ Open protocol

+ Expand

In Vivo Evaluation of DRE Antitumor Efficacy

Check if the same lab product or an alternative is used in the 5 most similar protocols

Six week old make CD-1 nu/nu mice were obtained from Charles River Laboratories and housed in constant laboratory conditions of 12-hour light/dark cycle, in accordance with the animal protocols. Following acclimatization, mice were subcutaneously injected in the right and left hind flanks with a colon cancer cell suspension (in PBS) at a concentration of 2 × 10⁶ cells/ mouse (HT-29, p53^−/− in the left flank and HCT116, p53^+/+ in the right flank). Tumors were allowed to develop (approximately a week), following which, the animals were randomized into treatment groups of 4 mice per group, an untreated control group and a DRE treatment group, as outlined in the toxicity studies above. The mice were orally gavaged with either PBS or DRE in PBS at 40 mg/kg/day for 75 days. All mice were assessed for toxicity, as well as efficacy of oral administration on the growth of tumors. The tumors were assessed every other day by measuring the length, width and height, using a standard caliper and the tumor volume was calculated according to the formula π/6 × length × width. The mice were also assessed for any weight loss for the duration of the study, which also lasted 75 day. Following the study, mice were sacrificed and their organs and tissues (livers, kidneys, hearts and tumors) were obtained and stored in formaldehyde for immunohistochemical and toxicological analysis.

Ovadje P., Ammar S., Guerrero J.A., Arnason J.T, & Pandey S. (2016). Dandelion root extract affects colorectal cancer proliferation and survival through the activation of multiple death signalling pathways. Oncotarget, 7(45), 73080-73100.

+ Open protocol

+ Expand

Glioma Xenograft Mouse Model

Check if the same lab product or an alternative is used in the 5 most similar protocols

All animal work was approved by the governmental authorities (Karlsruhe, Germany) and in accordance with the NIH ‘Guide for the Care and Use of Laboratory Animals’. Glioma cells were stereotactically implanted into the right brain hemisphere of CD1 nu/nu mice (Charles River Laboratories, Sulzfeld, Germany) at a depth of 3 mm. A detailed description of all animal work including magnetic resonance imaging (MRI) and two-photon microscopy is given in the Supplementary Information.

Kessler T., Sahm F., Blaes J., Osswald M., Rübmann P., Milford D., Urban S., Jestaedt L., Heiland S., Bendszus M., Hertenstein A., Pfenning P.N., de Almodóvar C.R., Wick A., Winkler F., von Deimling A., Platten M., Wick W, & Weiler M. (2015). Glioma cell VEGFR-2 confers resistance to chemotherapeutic and antiangiogenic treatments in PTEN-deficient glioblastoma. Oncotarget, 6(31), 31050-31068.

+ Open protocol

+ Expand

Conditional Smarca4 Knockout in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

All experimental procedures on animals were approved by the Government of Hamburg, Germany (N113/16, N050/2018, N099/2019) and were performed according to national regulations. Mice were kept on a 12 h dark/light cycle, and water and food were available ad libitum. Animals of both sexes were used for experiments. The strain Smarca4^fl/fl (also known as Brg1^fl/fl) has been previously generated and described [28 (link), 62 (link)], Math1-creER^T2 mice were obtained from Jackson Laboratories, ME, USA (#7684) [37 (link)], and CD1^nu/nu mice were obtained from Charles River Laboratories, MA, USA (#086) [45 (link)]. Math1creER^T2 and Smarca4^fl/fl mice were maintained on a C57Bl6/J background. Genotyping was performed by PCR using genomic DNA from ear or tail biopsies with the following primer pairs (5’-3’): cre (fw): TCCGGGCTGCCACGACCAA, cre (rv): GGCGCGGCAACACCATTTT, Smarca4 floxed (fw): GTCATACTTATGTCATAGCC, Smarca4 floxed (rv): GCCTTGTCTCAAACTGATAAG, Smarca4 recombined (fw): GATCAGCTCATGCCCTAAGG, Smarca4 recombined (rv): GCCTTGTCTCAAACTGATAAG. To induce Smarca4 recombination in Math1-creER^T2::Smarca4^fl/fl mice, pups received a single dose of 0.4 mg tamoxifen dissolved in corn oil by intraperitoneal injection at postnatal day 3 (P3).

Göbel C., Godbole S., Schoof M., Holdhof D., Kresbach C., Loose C., Neumann J, & Schüller U. (2023). MYC overexpression and SMARCA4 loss cooperate to drive medulloblastoma formation in mice. Acta Neuropathologica Communications, 11, 174.

+ Open protocol

+ Expand

Subcutaneous Injection of Green 1 in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

All procedures involving animals were carried out in accordance with the Canadian Council for Animal Care guidelines and approved by the University of Windsor’s Animal Care Committee. Six week old male CD-1 nu/nu mice were obtained from Charles River Laboratories and housed in constant laboratory conditions of a 12-hour light/dark cycle, in accordance with the animal protocols outlined in the University of Windsor Research Ethics Board- AUPP#: 10–17. Following acclimatization, the mice were separated into two main groups, one group was injected subcutaneously in the right and left hind flanks with Me₂SO in PBS (10 µL in 200 µL PBS), while the second group received subcutaneous injections of Green 1 (10 mg/kg/day for a total volume of 10 µL Green 1/200 µL PBS) three times a week for a period of one month. To assess toxicity while the mice were alive, body weights were measured three times a week for the duration of the study. Following the period of study, the animals were sacrificed and their organs and tissues (liver, kidneys and heart) were obtained and stored in 10% formaldehyde for immunohistochemical and toxicological analysis.

Larocque K., Ovadje P., Djurdjevic S., Mehdi M., Green J, & Pandey S. (2014). Novel Analogue of Colchicine Induces Selective Pro-Death Autophagy and Necrosis in Human Cancer Cells. PLoS ONE, 9(1), e87064.

+ Open protocol

+ Expand

Mouse Xenograft Tumor Studies with 264RAD and Trastuzumab

Check if the same lab product or an alternative is used in the 5 most similar protocols

All mouse experiments followed Home Office Guidelines determined by the Animals (Scientific Procedures) Act 1986. For all mouse studies, 264RAD and trastuzumab were dissolved in phosphate-buffered saline (PBS), at a final concentration of 10mg/kg. Estrogen pellets (0.25mg 60-day release, Innovative Research of America) were implanted subcutaneously into mice 24 hours prior to tumor cell injection. Female SCID-mice (6 to 8 weeks of age; with n ≥ 3/treatment; generous gift from Oncology iMED, AstraZeneca, Maccelsfield, UK) or female CD1 nu/nu mice (Charles River Laboratories) were inoculated subcutaneously with either 1x10⁶ MCF-7/HER2-18 cells in 200 μl of PBS or 1x10⁷ BT-474 cells in 1:1 PBS/Matrigel. Mice were randomized into treatment groups based on tumor volume (n ≥ 3/treatment). Mice received biweekly intraperitoneal injections (10mg/kg in 200 µl of PBS) of human immunoglobulin (IgG), 264RAD, trastuzumab, or both 264RAD and trastuzumab. Tumors were measured with calipers biweekly in two directions and tumor volume calculated using the formula (width² x length)/2. For further details, see the Supplementary Methods, avaible online.

Moore K.M., Thomas G.J., Duffy S.W., Warwick J., Gabe R., Chou P., Ellis I.O., Green A.R., Haider S., Brouilette K., Saha A., Vallath S., Bowen R., Chelala C., Eccles D., Tapper W.J., Thompson A.M., Quinlan P., Jordan L., Gillett C., Brentnall A., Violette S., Weinreb P.H., Kendrew J., Barry S.T., Hart I.R., Jones J.L, & Marshall J.F. (2014). Therapeutic Targeting of Integrin αvβ6 in Breast Cancer. JNCI Journal of the National Cancer Institute, 106(8), dju169.

+ Open protocol

+ Expand

Colon Cancer Xenograft Model: Evaluating LG and FOLFOX Therapy

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunocompromised CD1 nu/nu mice, aged 6 weeks, were obtained from Charles River
Laboratories (Wilmington, MA). Mice were housed, and the protocols were followed
using relevant guidelines and regulations that were approved by the University
of Windsor Animal Care Committee (AUPP #17-15) in accordance with the Canadian
Animal Care committee in a laboratory setting with 12-hour light/dark cycles.
Following an acclimatization period, mice were injected subcutaneously with
colon cancer cells (HT-29, HCT-116) cell lines suspension in Matrigel at a
concentration of 1.0 × 10⁶ cells per mouse in the hind flanks. On
tumor formation, mice were randomly separated into 4 groups (control [n = 3], LG
drinking water [n = 4], FOLFOX [n = 3] intraperitoneal injection, and FOLFOX
intraperitoneal injection [n = 4]). Control and chemotherapeutic mice were given
normal water, while LG treatment groups received water supplemented with 0.1
mg/mL LG (approximately 16 mg/kg/day) for 8 weeks. At 4 weeks, intraperitoneal
injections of FOLFOX (90 mg/kg folinic acid/50 mg/kg 5-fluorouracil/6 mg/kg
oxaliplatin) commenced once per week for 4 weeks. Mice were then sacrificed
using CO₂ chamber followed by cervical dislocation, and tumors were
harvested. Tumor volumes (using the formula ½ × [L × W2] to calculate
approximate volume) and body weights of each mouse were measured throughout the
length of the study once per week.

Ruvinov I., Nguyen C., Scaria B., Vegh C., Zaitoon O., Baskaran K., Mehaidli A., Nunes M, & Pandey S. (2019). Lemongrass Extract Possesses Potent Anticancer Activity Against Human Colon Cancers, Inhibits Tumorigenesis, Enhances Efficacy of FOLFOX, and Reduces Its Adverse Effects. Integrative Cancer Therapies, 18, 1534735419889150.

+ Open protocol

+ Expand

Genetically Engineered Mouse Models for Medulloblastoma Research

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Survivin^fl/fl (31 (link)), Ptc^fl/fl^{(65 (link))}, Math1-Cre-ER(66 (link))' Ptch +/-(67 (link)), and Math1CreER;ptc^fl/fl^{(30 (link))} (MERP) mice have been described previously. P4 MERP pups were gavaged with 0.8g/40μl of tamoxifen (T-5648, Sigma, St. Louis, MO) in corn oil to generate tumors. Tumors from Ptch^+/- and MERP mice were used for experiments. To allow for deletion of survivin in tumor cells, Survivin^fl/fl mice were crossed with Ptch^+/- mice to generate the Survivin ^fl/fl; Ptch^+/- (SP) line. CD-1 Nu/Nu mice were from Charles River Laboratories (Wilmington, MA). P7 wild type C57BL/6 pups were obtained from the SBMRI Animal Facility. All mice were maintained in the Animal Facility, and experiments were performed in accordance with national guidelines and regulations, and with the approval of the SBMRI Institutional Animal Care and Use Committee.

Brun S.N., Markant S.L., Esparza L.A., Garcia G., Terry D., Huang J.M., Pavlyukov M.S., Li X.N., Grant G.A., Crawford J.R., Levy M.L., Conway E.M., Smith L.H., Nakano I., Berezov A., Greene M.I., Wang Q, & Wechsler-Reya R.J. (2014). Survivin as a therapeutic target in Sonic hedgehog-driven medulloblastoma. Oncogene, 34(29), 3770-3779.

+ Open protocol

+ Expand

Tumor Growth Inhibition by JNJ

Check if the same lab product or an alternative is used in the 5 most similar protocols

All animal procedures were approved by the Ethical Committee of the Candiolo Cancer Institute and the Italian Ministry of Health. GTL-16 wild-type, GTL-16 human-delta-RAF1 and GTL-16 human-delta-BRAF cells (2 × 10⁶) were resuspended in 200ul of PBS and inoculated subcutaneously into the right posterior flanks of 6-week-old female CD-1 nu/nu mice (Charles River Laboratories). Mice were treated orally with 40 mg/kg/day of JNJ (the maximum tolerated dose) or vehicle. Treatment was initiated when the tumor volume reached approximately 50 mm³. Tumor volume was monitored every 3 days for 21 days.

Petti C., Picco G., Martelli M.L., Trisolini E., Bucci E., Perera T., Isella C, & Medico E. (2014). Truncated RAF kinases drive resistance to MET inhibition in MET-addicted cancer cells. Oncotarget, 6(1), 221-233.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!