Total RNA extraction and qRT-PCR were conducted as previously described [64 (link)]. The qRT-PCR forward and reverse primer sequences were as follows: (1) β-actin, CTCGCCTTTGCCGATCC and TTCTCCATGTCGTCCCAGTT; and (2) VARS1, CCGTGCTAGGAGAAGTGGTT and TCTCTGGTTTTGGTTTCTTCTCCC, respectively. The western blotting was performed as previously described (36) with primary antibodies against VARS1 (WH0007407M1, Sigma, Germany) and α-tubulin (A11126, Invitrogen, CA, USA).
A11126
Manufactured by Thermo Fisher Scientific
Sourced in United States, Denmark
The A11126 is a laboratory instrument designed for spectrophotometric analysis. It is capable of measuring the absorbance of light at various wavelengths, which can be used to quantify the concentration of substances in a sample.
Automatically generated - may contain errors
Lab products found in correlation
M per mammalian protein extraction reagent, by Thermo Fisher Scientific (1 mentions)
Complete mini, by Roche (1 mentions)
Nu page lithium dodecyl sulfate sample buffer, by Thermo Fisher Scientific (1 mentions)
Pierce phosphatase inhibitor mini tablets, by Thermo Fisher Scientific (1 mentions)
Nupage sample reducing agent, by Thermo Fisher Scientific (1 mentions)
Ab195268, by Abcam (1 mentions)
Mouse monoclonal anti actin, by Merck Group (1 mentions)
Nupage 4 to 12 polyacrylamide bis tris gels, by Thermo Fisher Scientific (1 mentions)
Bis tris protein gel, by Thermo Fisher Scientific (1 mentions)
Nupage, by Thermo Fisher Scientific (1 mentions)
α tubulin, by Thermo Fisher Scientific (1 mentions)
β actin, by Merck Group (1 mentions)
Alexa fluor 555, by Thermo Fisher Scientific (1 mentions)
Paraformaldehyde (pfa), by Merck Group (1 mentions)
Zen software, by Zeiss (1 mentions)
Ab65797, by Abcam (1 mentions)
Immobilon psq membrane, by Merck Group (1 mentions)
Rpn2109, by Cytiva (1 mentions)
Anti mpo, by Agilent Technologies (1 mentions)
Ap180p, by Merck Group (1 mentions)
9 protocols using a11126
1
Quantifying VARS1 Expression by qRT-PCR and Western Blot
2
Western Blot Analysis of Mitotic Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-cell lysates were prepared for Western blotting by incubating cells in M-PER mammalian protein extraction reagent (Life Technologies) with protease (Complete Mini, EDTA-free; Roche) and phosphatase inhibitors (Pierce Phosphatase Inhibitor Mini tablets; Thermo Scientific) on ice (10 min). Lysates were centrifuged at top speed in a microcentrifuge for 10 min. Before loading onto gels, samples were diluted with NuPAGE sample-reducing agent and NuPAGE lithium dodecyl sulfate (LDS) sample buffer (Life Technologies) and boiled (95°C, 5 min). Following protein separation on NuPAGE 4 to 12% polyacrylamide–bis-Tris gels (Life Technologies) and transfer to nitrocellulose, membranes were probed with primary antibodies. Primary antibodies used include monoclonal mouse anti-Mad2 (Santa Cruz Biotechnology; sc-374131), monoclonal mouse anti-actin (Sigma; A5441), monoclonal rabbit anti-BUB1 (Abcam; ab195268), monoclonal mouse anti-BUBR1 (Abcam; ab54894), monoclonal rabbit anti-BUB3 (Abcam; ab133699) and mouse anti-beta Tubulin (Invitrogen; A11126). Fluorescent dye-conjugated secondary antibodies (Li-Cor Biosciences) were used for infrared fluorescence-based detection (Odyssey CLX). Protein levels were quantified by measuring the relative fluorescence intensities of bands (normalized against actin) using Image Studio 2.1 software.
3
Western Blotting for Protein Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
4
Exosome Complex Protein Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Aliquots of total protein (30 μg) were loaded on 4%–12% SDS-polyacrylamide gels (NuPAGE 4%–12% Bis-Tris Protein Gels, ThermoFisher Scientific), transferred to a PVDF membrane with an iBlot2 PVDF Mini transfer stack (ThermoFisher Scientific), and subsequently probed with a polyclonal antibody recognizing EXOSC8 (Proteintech, 1:500), EXOSC3 (Proteintech, 1:1,000), EXOSC9 (Abcam ab156686, 1:1,000), RBM7 (Abcam ab84116, 1:500), β-actin (Sigma A1978, 1:2,000), and α-tubulin (Invitrogen A11126, 1:2,000).
5
Localization and Quantification of Kv7.4 in Rat Mesenteric Artery Myocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Freshly dissociated rat mesenteric artery myocytes were isolated as described previously by Jepps et al 16 and allowed to adhere to coverslips before being fixed in 4% paraformaldehyde (Sigma) in PBS for 30 minutes at room temperature. Cells were blocked, permeabilized, and stained as described previously. 16 Primary antibodies used were Kv7.4 (1:200; ab65797; Abcam, United Kingdom) and α-tubulin (1:1000; A11126; Invitrogen, Denmark), as well as wheat germ agglutinin Alexa Fluor 555 (as per the manufacturer's instructions; Life Technologies). Cells were visualized with structured illumination microscopy using a Zeiss Elyra PS.1 Super Resolution Microscope (Carl Zeiss, Germany). Midcell xy sections were selected and analyzed, and 3-dimensional reconstructions were created using Zen software (Carl Zeiss). Total cell fluorescence and intracellular fluorescence signals were quantified using Zen 2012 confocal software. Signals originating from the surface membrane, demarcated by wheat germ agglutinin, were obtained by subtracting the total intracellular signal from the total cell fluorescence signal, with both normalized to their respective areas, and background fluorescence was subtracted. The surface-associated signal was expressed subsequently as a percentage of the total cell fluorescence, as described previously. 17
6
SDS-PAGE and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells or NET-precipitated proteins were lysed on ice in SDS lysis buffer (2% SDS, 62.5 mM Tris at pH 6.8, 5% 2-mercaptoethanol, 10% glycerol) supplemented with Complete Roche Inhibitor Cocktail (Complete tablets Mini Easypack [catalog 04693124001] and PhosSTOP Easypack [catalog 04906837001]) and centrifuged at 13,000g for 15 minutes at 4°C. Whole-cell lysates (20–30 μg protein) were subjected to SDS-PAGE electrophoresis on 12.5% gels and then transferred to an Immobilon-PSQmembrane (catalog SEQ85R; Millipore). Membranes were blocked with 5% skimmed milk in TBS plus Tween 20 and then incubated with anti-MPO (1:3000 dilution; Dako) as loading control (78 (link)) or anti–IL-33 (1:1000 dilution) specific antibodies (mouse “Nessy” antibody; R&D). For HL-60 protein extracts, mouse anti–human tubulin antibody was used as loading control (1:3000 dilution, catalog A11126; Thermo Fisher Scientific). Detection was performed using relevant HRP-linked antibodies (anti–goat-HRP, anti–rabbit-HRP, anti–mouse-HRP; catalog AP180P, 12-348, and 12-349, respectively; all purchased from Millipore) and enhanced chemiluminescent-detection reagents (Amersham Biosciences, RPN2109). Unedited gels are provided in the online supplement.
7
Chromosome Alignment in Oocyte Maturation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For analysis of chromosome alignment, MI and MII oocytes were acquired after 9 h and 16 h of culture in M2 medium at 37°C, respectively. Intact oocytes were fixed and permeabilized in 2% paraformaldehyde in PHEM buffer ( PIPES, HEPES, EGTA, MgSO4) with 0.5% Triton X-100. Blocking was performed in 7% normal goat serum (10000C, Thermo Fisher Scientific) in phosphate-buffered saline (PBS) with 0.1% Tween-20 for overnight. Primary mouse monoclonal antibody (A11126, Thermo Fisher Scientific; diluted 1:400 in PBS with 3% BSA, 0.1% Tween-20) was then added and incubated overnight at 4°C. Secondary antibody was goat antimouse 488 (1:1,000; A11029, Thermo Fisher Scientific), incubated for 1 h at room temperature. Chromosomes were stained with Hoechst (H3569, Thermo Fisher Scientific; ) prior to mounting in ProLong Diamond antifade reagent.
8
Immunofluorescent Staining of Tubulin in BS-C-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BS-C-1 cells (CCL-26, American Type Culture Collection) were plated on custom, glass-bottom dishes (Catalog # PG35G-10C-NON, MatTek Corporation) fitted with high-performance Zeiss coverglasses (Catalog # 474030-9000-00, Thickness 1.5) at a density of 20,000 cells and incubated for 16–24 h. The coverglasses were cleaned by sonicating them sequentially in 50% HPLC grade ethanol, 1 mM HCL in 50% HPLC grade ethanol, and 1 M KOH in 50% HPLC grade ethanol for 20 min each with extensive washing using MilliQ water after every sonication. The cells were fixed using 3.4% paraformaldehyde (Electron Microscopy Sciences) in PBS for 10 min at 37 °C. The fixed cells were then permeabilized using 0.1% Triton X-100 in PBS for 10 min at room temperature. Cells were then preblocked with 5% BSA (Catalog # BP1600, Fisher Scientific), incubated with mouse α-tubulin antibody (Catalog # A11126, Thermo Fisher Scientific, diluted 200-fold in 1% BSA/PBS) for 30 min at room temperature, and treated with goat serum (Catalog # G6767, Sigma, diluted 50-fold in 1% BSA/PBS). Bound primary antibody was counter-stained with Alexa 647-labeled goat anti-mouse IgG (Catalog # A-21236, Thermo Fisher Scientific, diluted 750-fold in 1% BSA/PBS) for 30 min at room temperature.
9
STEAP3 Expression in Renal Cell Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tianjin Institute of Urology (Tianjin, China) provided the 786‐O and A498 cell lines. Afterward, cells were cultured in RPMI‐1640 (C11875500BT, Gibco) with 10% fetal bovine serum (04‐001‐1A, Biological Industries) and 1% penicillin–streptomycin (C7072, Bioss) at 37°C.
The primary anti‐STEAP3 (PA5‐62202, Thermo Scientific) and anti‐alpha‐tubulin (A11126, Thermo Scientific) rabbit antibodies were diluted following the manufacturer's specifications.
The primary anti‐STEAP3 (PA5‐62202, Thermo Scientific) and anti‐alpha‐tubulin (A11126, Thermo Scientific) rabbit antibodies were diluted following the manufacturer's specifications.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!