The largest database of trusted experimental protocols

37 protocols using mir control

1

Regulation of HMGA2 by miR-195

Check if the same lab product or an alternative is used in the 5 most similar protocols
EC109 and EC9706 cells were seeded in 6-well plates and transfected with miR-195 mimics, miR-control, anti-miR-195, anti-miR-control, pcDNA-HMGA2, pcDNA empty vector, si-HMGA2, or si-control (GenePharma, Shanghai, China) by Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer's protocol when the cells were grown to 80% confluency.
+ Open protocol
+ Expand
2

Knockdown of SNHG3 by siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Small interfering RNA targeting SNHG3 (si-SNHG3 #1, 5ʹ-GGGAGAGUAGGUAAACUGA-3ʹ; si-SNHG3 #2, 5ʹ-UGGUACUGUU GAAGGAAAC-3ʹ; SNHG3 #3, 5ʹ-GCUAAGAGGAGUGAGGCAG-3ʹ), si-control (5ʹ-TTCTCCGAACGTGTCACGT-3ʹ), miR-216a (5ʹ-UAAUCUCAGCUGGCAAC UGUGA-3ʹ), miR-control (5ʹ-CCGACUGCAGUCGC-3ʹ), and anti-miR-216a (5ʹ-GCAGCGCCTGTGAGAGGGAT GAAAA-3ʹ) were acquired from GenePharma (China). The sequences of SNHG3 (NR_036473.1) were amplified with primers (Forward 5ʹ-TGACGGAGTCGGTTTGTCACTC-3ʹ; Reverse 5ʹ-ACGAATGGGGCTGA CTCATCTG-3ʹ) and incorporated into the pcDNA-3.1 vector (Invitrogen, USA) to create pcDNA-SNHG3 (SNHG3). Cells were transfected using Lipofectamine 2000 (Invitrogen, USA).
+ Open protocol
+ Expand
3

Lentiviral Knockdown of miR-29b in bEnd.3 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The GFP-expressing lentivectors encoding miR-29b or Zip-miR-29b, miR-control and polybrene were purchased from GenePharma (Shanghai, China). The lentivector stably knockdown miR-29b (Zip-miR-29b) expression contained the following shRNA sequence: 5'- GATCCGTAGCACCATGAAATCAGTGTTTCAA GAGAACACTGATTTCAAATGGTGCTACTTTTTTG- 3'. Prior to transfection, bEnd.3 cell were seeded in six-well plates (2×105 cells per well) and incubated overnight, then transduced with lentiviral supernatants containing lentiviral vectors coding for the miR-29b, Zip-miR-29b, or miR-control, respectively, and 5μg/mL polybrene at room temperature for 24 hrs. Culture media were then removed and replaced with fresh DMEM containing 10% FBS and incubated for 72 hrs in the presence of puromycin (10μg/mL) for selection. The transduction efficiency was monitored by qPCR for the miR-29b expression.
+ Open protocol
+ Expand
4

Capn4 Overexpression and miR-124 Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pcDNA-Capn4 and pcDNA-control were purchased from Thermo Fisher Scientific. We purchased miR-124 mimics, anti-miR-124, and miR-control from GenePharma (Shanghai, China). Cell transfection was performed using Lipofectamine 2000 (Thermo Fisher Scientific).
+ Open protocol
+ Expand
5

Stable Transfection of Anti-miR-361-5p in BC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the stable transfection of anti-miR-361-5p, anti-miR-361-5p sequence were amplified from miRZip-361-5p construct (System Biosciences) and cloned into pSilencer4.1 system. BC cells were then transfected with the pSliencer vector containing the antisense sequence of miR-361-5p. The cells were selected by puromycin after 48 h transfection and then diluted. MiR-361-5p mimics, miR-control, FGFR1 siRNA, MMP-1 siRNA or siRNA negative control were purchased from Genepharma (China). FGFR1 and MMP-1 cDNA ORF Clone were purchased from Origene (Origene Technology). Transient transfections were performed by using Lipofectamine 2000 (Invitrogen) following the manufacturer’s protocol. Cells were kept in medium containing 2% FBS for 48 h and then harvested and used.
+ Open protocol
+ Expand
6

Transfection of Human Osteosarcoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human osteosarcoma cell lines (including MG-63,U2OS,Saos-2 and SJSA-1), the normal bone cell line hFOB, and HEK293 cell line were purchased from the American Type Culture Collection (Manassas,VA, USA). These cell lines were cultured in Dulbecco’s modified Eagle medium (DMEM; Gibco, Invitrogen Life Technologies, Carlsbad, CA, USA) supplemented with 10 % fetal bovine serum (FBS). Cells were incubated at 37 °C in 5 % CO2 humidity, and were passaged every 2–3 days. MiR-138 mimic (40 nM), miR-138 inhibitor (40 nM), DEC2-pcDNA3.1 (100 ng), DEC2 siRNA (100 ng) and the negative controls, including miR-Control (40 nM), pcDNA3.1 vector (100 ng), siRNA-Contrl (100 ng) were all purchased from GenePharma (Shanghai, China), and were transfected using Lipofectamine 2000 (Invitrogen Life Technologies), according to the manufacturer’s instructions. About 48 h after transfection, the transfection efficiency was assessed. The cells could be used for subsequent analysis when the transfection efficiency was above 80 %.
+ Open protocol
+ Expand
7

Overexpression of miR-375 in Glioma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MiR-375 mimic and miR-control were purchased from GenePharma (Shanghai, China). MiRNA transfections were performed using Lipofectamine 2000 (Invitrogen, Carlsbad, USA), according to the manufacturer’s instructions. The extent of overexpression was evaluated by qRT-PCR 24 h after transfection. MiR-375 mimic and miR-control lentiviruses were synthesised by Genechem (Shanghai, China). For stable overexpression of miR-375 in glioma cells, MiR-375 mimic or miR-control lentiviruses were added to cells, according to the manufacturer’s protocol. After 24 h, clones with stable expression were selected by incubating cells for 3 weeks with 5 μg/mL puromycin (Sigma, St Louis, USA) in complete medium containing 10% FBS. The sequences of miR-control and MiR-375 mimic were 5′-TTCTCCGAACGTGTCACGT-3′ and 5′-TTTGTTCGTTCGGCTCGCGTGA-3′, respectively.
+ Open protocol
+ Expand
8

Transfection of miR-155-5p in MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
miR‐155‐5p mimics, inhibitors, and a negative control (miR‐control) were purchased from GenePharma. In brief, 1 × 106 of MSCs was plated in 10cm plate and then transiently transfected with 50 nM miR‐155‐5p mimics, inhibitors or miR‐control using Lipofectamine 2000 transfection reagent (Invitrogen, 11668027) according to the protocol, respectively. The MSCs were incubated at a 37°C and 5% CO2 incubator for 48 hr for transfection and then harvested for further experiments. The transfection experiments were repeated at least three times.
+ Open protocol
+ Expand
9

Transfection of miR-183-5p in MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
miR-control, miR-183-5p mimic and inhibitor were commercially acquired from GenePharma (Shanghai, China). Briefly, 1 × 106 MSCs were plated on a 10-cm culture dish and transfected with 50 nM miR-183-5p mimic, inhibitor or miR-control using Lipofectamine 2000 transfection reagent (Invitrogen, 11668027) according to the manufacturer’s instructions. Subsequently, MSCs were cultured at 37 °C in a 5% CO2 incubator for 48 h and then harvested for further experiments.
+ Open protocol
+ Expand
10

Manipulating NSCLC Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Two NSCLC cell lines (H1299 and A549) and human bronchial epithelial cells (HBE) were purchased from China center for type culture collection (Wuhan, China). All cells were cultivated in RPMI-1640 medium (Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS; Thermo Fisher Scientific) in an incubator with the parameters of 37°C, 5% CO2. Small interfering RNA (siRNA) targeting PTV1 (si-PTV1, 5ʹ-GCUUGGAGGCUGAGGAGUUTT-3ʹ) and its mock (control), miR-17-5p mimics (miR-17-5p) and its matched negative control (miR-control), miR-17-5p inhibitor and its matched negative control (inhibitor- control), siRNA against BAMBI (si-BAMBI) and its mock (si-control) were obtained from GenePharma (Shanghai, China). The sequences of BAMBI were inserted into pcDNA (Hanbio Biotechnology, Shanghai, China) to construct the overexpression vector of BAMBI (pcDNA-BAMBI). Cell transfection was conducted using Lipofectamine 2000 Reagent (Invitrogen) according to the manufacturer’s manual.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!