Lightcycler 480 2 rt pcr system

Manufactured by Roche

Sourced in Switzerland, United States, Germany

The LightCycler® 480 II RT-PCR System is a real-time PCR instrument designed for nucleic acid quantification and detection. It features a high-performance optical system and advanced software for precise and reliable analysis of samples.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (6 mentions) Primescript rt reagent kit, by Takara Bio (3 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (3 mentions) Sybr premix ex taqtm 2, by Takara Bio (2 mentions) M mlv reverse transcriptase, by Promega (2 mentions) Sybr premix ex taq 2, by Takara Bio (2 mentions) Nanodrop, by Thermo Fisher Scientific (2 mentions) Rneasy plant mini kit, by Qiagen (1 mentions) Primescript rt pcr kit, by Takara Bio (1 mentions) Sybr green 1, by Takara Bio (1 mentions) Kapa sybr fast qpcr master mix, by Roche (1 mentions) Lightcycler 480 probes master kit, by Roche (1 mentions) Powertrack sybr green master mix, by Thermo Fisher Scientific (1 mentions) Tri reagent, by Molecular Research Center (1 mentions) Anti cd19 fitc, by BioLegend (1 mentions) Anti cd69 apc, by BioLegend (1 mentions) Magnetic activated cell sorting (macs), by Miltenyi Biotec (1 mentions) Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions) Thermo scientific revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions)

Close spelling variants of this product

LightCycler 480 (7708 citations) LightCycler 480 system (2847 citations) LightCycler 480 II (2686 citations) LightCycler (1119 citations) LightCycler 480 II system (759 citations) LightCycler 2.0 (468 citations) LightCycler system (466 citations) LightCycler 480 PCR system (227 citations) LightCycler 480 II PCR system (46 citations) LightCycler 480 RT-PCR system (42 citations)

20 protocols using lightcycler 480 2 rt pcr system

Quantifying Gene Expression in Plant Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of seed and protocorm samples was extracted using RNeasy^® Plant Mini Kit (QIAGEN, Germany) according to the manufacturer’s instructions. Primers designed with Primer Premier 5.0 are shown in Table 1. A PrimerScoript™ RT reagent Kit (TaKaRa, Japan) was used for reverse transcription. First, 1 μl RT product diluted with 20 μl ddH₂O was used as a template. Then, qPCR was performed in 15 µl reaction mixture containing 7.5 µl of 2× SYBR^® Premix Ex TaqTM II (TaKaRa, Japan), 1.5 µl of cDNA template, and 0.3 µl of each gene specific primers. Overall, we preformed three biological replicates and three technical replicates using the LightCycler^® 480 II RT-PCR System (Roche, Switzerland). The parameters for the reactions were: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. The cDNA libraries were standardized to housekeeping gene 18S rRNA. The 2^−ΔΔCt method was used for evaluating gene expression.Table 1

The quantitative PCR primers of putative genes

Gene ID	Forward primer (5′–3′)	Reverse primer (5′–3′)
18S rRNA	CCAGGTCCAGACATAGTAAG	GTACAAAGGGCAGGGACGTA
c48836	AACCTCTTCCGCCATACCTGC	GCTCTCCGCTTCAACTGACCA
c54199	GGCGTTGTGGAGAGCATTGGA	TTTGTCCGTGCCATGCCTTTCA
c81881	ATGCCGCCTCGTGGAAGACA	GTTGAGACCGCTGCCCGTTTAG
c51606	CCAATCGCAGTGCCAGTTCTTC	AGAGCATCCTGTGTTCCGTTGT
c81941	GATGCGGCACAAGGAGACCAA	TGAGTCGTCGTCAGCACTACCT
c47345	GTCTCAGCGAGCAACAGATGGT	GCGAGCAAAGAGCAAGCACAT

Zeng X., Li Y., Ling H., Chen J, & Guo S. (2018). Revealing proteins associated with symbiotic germination of Gastrodia elata by proteomic analysis. Botanical Studies, 59, 8.

+ Open protocol

+ Expand

Quantification of miR-155 and lncRNA GAS5 in NPCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from NPCs using TRIzol reagent; the purity and quantity of RNA were assessed using a NanoDrop 1000 system. RT was performed on an ABI Veriti gradient PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using a PrimeScript^™ RT-PCR kit (Takara Bio, Inc., Otsu, Japan), the reaction conditions were: 30°C for 10 min, 42°C for 30 min and 72°C for 15 min. The following primers were used: Hsa-miR-155-5p forward, 5′-GGGGGTAATGCTAATCGTGAT-3′ and reverse, 5′-GTGCGTGTCGTGGAGTCG-3′; U6 forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3′; lncRNA GAS5 sense, 5′-GCTTACTGCTTGAAAGGGTCT-3′ and antisense, 5′-CACTGGGAGGCTGAGGAT-3′; β-actin sense, 5′-GCACCACACCTTCTACAATGAG-3′ and antisense, 5′-ACAGCCTGGATAGCAACGT-3′. qPCR was performed on a Light Cycler 480 II RT-PCR system (Roche Diagnostics, Indianapolis, IN, USA) with SYBR-Green I (Takara Bio, Inc.). The reaction conditions were: 95°C for 30 sec, 95°C for 5 sec and 60°C for 30 sec (40 cycles). Each experiment was repeated three times, the relative mRNA expression levels were evaluated by the 2^−ΔΔCq method (24 (link)).

Wang Y., Song Q., Huang X., Chen Z., Zhang F., Wang K., Huang G, & Shen H. (2019). Long noncoding RNA GAS5 promotes apoptosis in primary nucleus pulposus cells derived from the human intervertebral disc via Bcl-2 downregulation and caspase-3 upregulation. Molecular Medicine Reports, 19(3), 2164-2172.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol^® Reagent (ThermoFisher). A quantity of 5 μg of total RNA was used as the template for cDNA strain synthesis using M-MLV reverse transcriptase (ThermoFisher) according to the manufacturer’s instructions. qRT-PCR analysis was performed in a LightCycler^® 480 II RTPCR system (Roche Applied Sciences, Manheim, Germany) using KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems). Primer information is shown in the Supplementary Materials and Methods, Table S3. The expression levels of mRNA were normalized against the level of β-actin mRNA (ACTB) in the same samples.

Chiang S.K., Chang W.C., Chen S.E, & Chang L.C. (2019). DOCK1 Regulates Growth and Motility through the RRP1B-Claudin-1 Pathway in Claudin-Low Breast Cancer Cells. Cancers, 11(11), 1762.

+ Open protocol

+ Expand

miR-126 Expression Analysis in Urine

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative real-time PCR was used to analyze the amount of miRNA in the urine samples. miR-126 was amplified using LightCycler 480 Probes Master kit (Roche Applied Science, Germany) and examined using TaqManTM MicroRNA hsa-miR-126-specific primers (Applied Biosystems). Real-time PCR was performed on a LightCycler 480 II RT-PCR System (Roche Applied Science, Germany) with the following condition: 94°C for 120 seconds followed by 45 cycles of 94°C for 20 seconds, 56°C for 10 seconds, and 70°C for 20 seconds, using the LightCycler 480 Probes Master kit (Roche Applied Science, Germany). Nontemplate reaction controls produced no detectable signals in any of the experiments. Each urine sample was extracted in triplicate, followed by simultaneous reverse transcription and triplicate analysis through real-time PCR. The microRNA level was quantified using the formula 2^(50-Ct). Data are expressed in lg unit.

Liu Y., Gao G., Yang C., Zhou K., Shen B., Liang H, & Jiang X. (2014). Stability of miR-126 in Urine and Its Potential as a Biomarker for Renal Endothelial Injury with Diabetic Nephropathy. International Journal of Endocrinology, 2014, 393109.

+ Open protocol

+ Expand

Quantifying Inflammatory Markers in Intestine

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA of intestine tissues was isolated using TRI Reagent (Molecular Research Center Inc. # TR118). cDNA synthesis was performed using M-MLV reverse transcriptase (Invitrogen, #28025-013). Gene expression was measured using PowerTrack SYBR Green Master Mix (Invitrogen, #A46012). The quantitative PCR (qPCR) reactions were run in the Roche Lightcycler 480-II RT-PCR system. Primers used in this study were purchased from Integrated DNA Technologies, Coralville, IA. Primer sequences used in this study include: il-1β forward 5′-CAACCAACAAGTGATATTCTCCATG-3′, reverse 5′-GATCCACACTCTCCAGCTGCA-3′, il-6 forward 5′-TAGTCCTTCCTACCCCAATTTCC-3′, reverse 5′-TTGGTCCTTAGCCACTCCTTC-3′, Tnf-α forward 5′-CAAAATTCGAGTGACAAGCCTG-3′, reverse 5′-GAGATCCATGCCGTTGGC-3′, Il-22 forward 5′-ATGAGTTTTTCCCTTATGGGGAC-3′ reverse 5′-GCTGGAAGTTGGACACCTCAA-3′, il-23 forward 5′-ATGCTGGATTGCAGAGCAGTA-3′ reverse 5′-ACGGGGCACATTATTTTTAGTCT-3′. Data were normalized with Rplp0 measurements for relative quantitation. Rplp0 forward 5′-AGATTCGGGATATGCTGTTGG-3′ reverse 5′-TCGGGTCCTAGACCACTGTTC-3′.

Mitchell S.B., Hung Y.H., Thorn T.L., Zou J., Baser F., Gulec S., Cheung C, & Aydemir T.B. (2023). Sucrose-induced hyperglycemia dysregulates intestinal zinc metabolism and integrity: risk factors for chronic diseases. Frontiers in Nutrition, 10, 1220533.

+ Open protocol

+ Expand

SLE Autoantibody and B Cell Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood samples were collected from SLE patients and health controls. The serum was acquired by using a standard serum separator tube. Anti-dsDNA was quantified by autoantibodies profile assay kit (chemiluminescent microparticle immunoassay) (HOB, Jiangsu, China). Cell surface markers was stained with the following fluorochrome-labeled monoclone antibodies: FITC anti-CD19 (Clone# HIB19, Biolegend, San Diego, CA)，APC anti-CD69 (Clone# FN50, Biolegend, San Diego, CA). B cells from peripheral blood were isolated with the immunomagnetic cell sorting (MACS) (Miltenyi Biotec, Bergisch Gladbach, Germany). Total RNA in B cells was extracted using total RNA purification solutions (Invitrogen, Carlsbad, CA) and then transcribed into cDNA using commercial kits (TransGen, Beijing, China). The primers were designed according to Genbank sequences and synthesized by Invitrogen Company. Primers for the following transcripts were as follows: SMS1 CAACATTGGCGTAGACAT (forward), TAGGAGGTACTCGTTCGTG-(reverse)；GAPDH GCACCGTCAAGGCTGAGAAC (forward), TGGTGAAGACGCCAGTGGA (reverse). Then the expression of SMS1 was measured using Lightcycler 480II RT-PCR System (Roche, Switzerland).

Wang C., Ming B., Wu X., Wu T., Cai S., Hu P., Tang J., Tan Z., Liu C., Zhong J., Zheng F, & Dong L. (2019). Sphingomyelin synthase 1 enhances BCR signaling to promote lupus-like autoimmune response. EBioMedicine, 45, 578-587.

+ Open protocol

+ Expand

Quantifying Gene Expression in Root Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of the root samples was extracted by the method described above. The primers designed with Primer Premier 6.0 are shown in Supplementary Table S1. A PrimeScript^™ RT reagent Kit (TaKaRa, Japan) was used for reverse transcription. First, the RT product (1 μl) was diluted with 20 μl ddH₂O and used as a template. Then, qPCR was performed in a 15 μl reaction mixture containing 7.5 μl of 2 × SYBR^® Premix Ex Taq^™ II (TaKaRa, Japan), 1.5 μl of cDNA template, and 0.3 μl of each gene specific primers. Three biological replicates and three technical replicates were conducted using the LightCycler^® 480II RT-PCR System (Roche, Switzerland). The parameters for the reactions were 95°C for 30 s, 40 cycles of 95°C for 5 s, and 60°C for 30s. The cDNA libraries were standardized to housekeeping gene 18S rRNA (Zhang et al., 2012 (link)). The 2^−ΔΔCt method was used for evaluating gene expression.

Shan T., Zhou L., Li B., Chen X., Guo S., Wang A., Tian L, & Liu J. (2021). The Plant Growth-Promoting Fungus MF23 (Mycena sp.) Increases Production of Dendrobium officinale (Orchidaceae) by Affecting Nitrogen Uptake and Assimilation. Frontiers in Plant Science, 12, 693561.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells pellets or tumor specimen using TRIzol reagent and reverse transcribed with the PrimeScript RT-PCR kit. The A260/A280 ratio was calculated to assess RNA quality and purity. qRT-PCR analysis was performed on LightCycler 480II RT-PCR system (Roche, Basel, Switzerland) at the recommended thermal cycling settings: one initial cycle at 95°C for 30 s followed by 55 cycles of 15 s at 95°C, 20 s at 60°C, and 15 s at 72°C. Gene primers are represented in Table 2.

Sun C., Wang L., Du D.D., Ji J.B., Yang X.X., Yu B.F., Shang P.F, & Guo X.L. (2022). DSC2 Suppresses the Metastasis of Gastric Cancer through Inhibiting the BRD4/Snail Signaling Pathway and the Transcriptional Activity of β-Catenin. Oxidative Medicine and Cellular Longevity, 2022, 4813571.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of mediobasal hypothalamic tissue samples and epididymal adipose tissue sample were extracted using the Trizol Reagent (Invitrogen, USA, Cat No. 15596-028) within 1 h. RNA content was assessed, and purity was determined as per A260/A280 ratios. A Prime Script RT reagent kit with gDNA Eraser was used (Takara BioInc, Japan, Lot No. RR047A) for reverse transcription of the first-strand complementary DNA as per the manufacturer’s instructions. Primers used are listed in Table 1. SOCS3, PTP1B, leptin receptor (LepRb), pro-opiomelanocortin (POMC) and neuropeptide (NPY) in the hypothalamic tissue and α7nAchR, IKKβ, NF-KB in the adipose tissue were determined. RT-qPCR was performed using the LightCycler 480 II RT-PCR system (Roche). The mRNA levels were normalized to GAPDH, which served as the internal control. The level of expression for each gene was calculated by the comparative threshold cycle value (Ct) method, using the formula 2-ΔΔCt (Where ΔΔCt=ΔCt sample-ΔCt reference) (Cheng et al., 2008 (link)). Every sample was performed in triplicate to confirm amplification specificity.

Jiang P., Ma D., Wang X., Wang Y., Bi Y., Yang J., Wang X, & Li X. (2018). Astragaloside IV Prevents Obesity-Associated Hypertension by Improving Pro-Inflammatory Reaction and Leptin Resistance. Molecules and Cells, 41(3), 244-255.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from the same libraries was used for quantitative PCR analyses (Livak and Schmittgen 2001 (link); Liu et al. 2015a (link)). Primers designed with Primer Premier 5.0 are shown in Additional file 1: Table S1. PrimeScript™ RT reagent Kit (TaKaRa, JAP) was used for reverse transcription. In total, 1 μl of RT product diluted with 20 μl of ddH₂O was used as template. Then, qPCR was performed in 15 μl of reaction mixture containing 7.5 μl of 2× SYBR^® Premix Ex Taq™ II (TaKaRa, JAP), 1.5 μl of cDNA template, and 0.3 μl of each gene-specific primer. In total, we performed two biological replicates and three technical replicates using the LightCycler^® 480 II RT-PCR System (Roche, SWIT) and its relative quantification software. The parameters of reactions were: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. The cDNA libraries were standardized to reference gene 18S. The 2^−ΔΔCt method was used for evaluating gene expression.

Zeng X., Li Y., Ling H., Liu S., Liu M., Chen J, & Guo S. (2017). Transcriptomic analyses reveal clathrin-mediated endocytosis involved in symbiotic seed germination of Gastrodia elata. Botanical Studies, 58, 31.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!