Abi prism 3730xl dna sequencer

Nested PCR was performed on RSV positive samples detected by qPCR. The first round of amplification was carried out with the forward primer AG20, 5′‐GGGGCAAATGCAAACATGTCC‐3′, and the reverse primer F164, 5′‐GTTATGACACTGGTATACCAACC‐3′. The PCR parameters were as follows. After denaturation of cDNA samples at 94°C for 5 min, the amplification was performed in 40 cycles consisting of a denaturing step for 30 sec at 94°C, a primer annealing step for 30 sec at 54°C, and an elongation step for 1 min at 72°C, followed by extension at 72°C for 10 min. The first round PCR products were used as templates in the second round amplification with the primers BG10, 5′‐GCAATGATAATCTCAACCTC‐3′, and F1, 5′‐CAACTCCATTGTTATTTGCC‐3′. Thermocycling conditions were: 94°C for 5 min, followed by 30 cycles of 94°C for 45 sec, 54°C for 45 sec, and 72°C for 1 min, followed by a final extension at 72°C for 10 min [Agoti et al., 2012]. PCR products from positive reactions were confirmed on 1% agarose gels and were either sequenced directly or purified with an E.Z.N.A. Gel Extraction Kit (OMEGA, Norcross, GA) before being sequenced. All sequencing was performed by Comate Bioscience (Jilin Co., Ltd., Changchun, China) using the BigDye Terminatorv 3.1 kit and ABI‐PRISM 3730XL DNA sequencer (Applied Biosystems).

Genomic DNA of cells was isolated using the TIANamp genomic DNA kit (DP304, Tiangen, China). Then, DNA was treated with a DNA bisulfite conversion kit (DP215, Tiangen, China) in accord with the the manufacturer’s instructions. Aliquots of the bisulfite-treated DNA were subjected to 45 cycles of PCR amplification. PCR primers in the same regions of MSP were designed using the CpG island search engine MethPrimer, which are shown in Table S3. The final PCR products were cloned using the pMD19-T vector cloning kit (Takara) and clones (at least 10 for each promoter region for each gene) were sequenced using an automated ABI Prism 3730XL DNA sequencer (Applied Biosystems, USA).