Emsa gel shift kit

Manufactured by Panomics

Sourced in United States

The EMSA Gel-Shift Kit is a laboratory equipment used to perform Electrophoretic Mobility Shift Assay (EMSA), also known as a gel-shift assay. The kit provides the necessary components to study the interaction between DNA or RNA and proteins.

Automatically generated - may contain errors

Lab products found in correlation

Pall biodyne b nylon membrane, by Pall Corporation (2 mentions) Enhanced chemi luminescence (ecl), by Cytiva (1 mentions) X omat autoradiography film, by Kodak (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Nuclear extraction kit, by Thermo Fisher Scientific (1 mentions) Accupower rt premix kit, by Bioneer (1 mentions) Mca1360, by Bio-Rad (1 mentions) Ne per nuclear and cytoplasmic extraction kit, by Thermo Fisher Scientific (1 mentions) Mouse igg1, by BD (1 mentions) Western lightning plus ecl, by PerkinElmer (1 mentions) P akt 9271, by Cell Signaling Technology (1 mentions) Nuclear extract kit, by Panomics (1 mentions) Donkey anti goat igg hrp, by Santa Cruz Biotechnology (1 mentions) Cyclin b1 sc 245, by Santa Cruz Biotechnology (1 mentions) Gapdh sc 20357, by Santa Cruz Biotechnology (1 mentions) Cyclin a sc 751, by Santa Cruz Biotechnology (1 mentions) P atm sc 47739, by Santa Cruz Biotechnology (1 mentions) Goat anti rabbit igg horseradish peroxidase hrp sc 2004, by Santa Cruz Biotechnology (1 mentions) Goat anti mouse igg hrp sc 2005, by Santa Cruz Biotechnology (1 mentions) Immobilon ny membrane, by Merck Group (1 mentions)

Close spelling variants of this product

Gel-Shift Kit (11 citations) EMSA kit (9 citations)

10 protocols using emsa gel shift kit

Quantifying NF-κB Binding in Nuclear Extracts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Binding of NF-κB in nuclear extracts was assessed by the electrophoretic mobility shift assay (EMSA) using biotin-labeled double-stranded NF-κB (5′-CCAGTGGAATTCCCCAG-3′) oligonucleotides (EMSA Gel Shift Kit, Panomics Inc.). Binding reactions were carried out for 30 min at 15°C in a 25 μl mixture containing 6 μg of nuclear protein, 10 mM Tris, 50 mM KCl, 1 mM dithiothreitol, 5 mM MgCl₂, 0.06% bromophenol blue, 0.25 μg of BSA, 2 μg poly(dI-dC), and 2 pmol of oligonucleotide probe (10 ng biotin-labeled NF-κB(p65) probe). Binding specificity was confirmed by competition with a 200-fold excess of unlabeled NF-κB oligonucleotides. Nuclear extracts from HeLa cells were also used as a positive CTR (EMSA Gel Shift Kit, Panomics). Protein-DNA complexes were separated through 6% nondenaturing polyacrylamide gel electrophoresis (PAGE, 120 V in 0.5% Tris-borate-EDTA), transferred to positively charged nylon membranes (Pall Biodyne B® membrane, Pall Corporation, East Hills, NY) at 300 mA for 30 min, and UV cross-linked for 3 min. After blocking, bands were visualized by streptavidin-horseradish peroxidase (HRP) reaction, followed by the enhanced chemiluminescence detection system (ECL, Amersham) and exposure to Kodak X-OMAT Autoradiography Film. Bands were quantified by densitometry using NIH-ImageJ software.

Martorana F., Foti M., Virtuoso A., Gaglio D., Aprea F., Latronico T., Rossano R., Riccio P., Papa M., Alberghina L, & Colangelo A.M. (2019). Differential Modulation of NF-κB in Neurons and Astrocytes Underlies Neuroprotection and Antigliosis Activity of Natural Antioxidant Molecules. Oxidative Medicine and Cellular Longevity, 2019, 8056904.

+ Open protocol

+ Expand

Reverse Transcription and EMSA for STAT3

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from YD-38 cells were prepared using RNeasy Mini kit (Quiagen, CA, USA) according to the manufacturer's instructions. Equal amount of RNA from each sample reverse transcribed using AccuPower RT-premix kit (Bioneer, Korea) and oligo(dT) primers. PCR was performed using 2 µl of the reverse transcription product. The PCR reactions were performed in 25-30 cycles of denaturation 94-95˚C, annealing 56-60˚C and an extension of 72˚C. The primers used for the amplification are listed in the Table I. After amplification, the products were visualized in 1.2% agarose containing ethidium bromide.
Electrophoretic mobility shift assay (EMSA). STAT3 DNA binding activity was detected using EMSA (19) . Gingival cancer cells were grown to ~80% confluence and nuclear protein extracts were prepared using the Nuclear Extraction kit (Affymetrix, CA, USA). EMSA was performed with EMSA gel shift kit (Panomics) according to the manufacturer's protocol. Briefly, the nuclear proteins prepared were subjected for hybridization with a double-stranded, biotin-labeled oligonucleotide probe containing the consensus-binding site for STAT3 (sense strand, 5'-CATGTTATGCATATTCCTGTAAGTG-3'). The protein-DNA complexes were resolved in a 6% non-denaturing PAGE gel and transferred to Pall Biodyne B nylon membrane (Pall Life Sciences, NY, USA) and detected using streptavidin-HRP and a chemiluminescent substrate.

Darvin P., Baeg S.J., Joung Y.H., Sp N., Kang D.Y., Byun H.J., Park J.U, & Yang Y.M. (2015). Tannic acid inhibits the Jak2/STAT3 pathway and induces G1/S arrest and mitochondrial apoptosis in YD-38 gingival cancer cells. International journal of oncology, 47(3).

+ Open protocol

+ Expand

EMSA Protocol for E-cadherin and Vimentin

Check if the same lab product or an alternative is used in the 5 most similar protocols

The EMSA assay was performed by EMSA Gel-Shift Kit (Panomics, Inc., Santa Clara, CA, USA) according to manufacturer's protocol. WT and mutant probes of E-cadherin and vimentin were shown in Supplementary Table 3. An anti-V5 antibody (MCA1360; AbD Serotec) was added in supershift experiments.

Li H.J., Yu P.N., Huang K.Y., Su H.Y., Hsiao T.H., Chang C.P., Yu M.H, & Lin Y.W. (2015). NKX6.1 functions as a metastatic suppressor through epigenetic regulation of the epithelial–mesenchymal transition. Oncogene, 35(17), 2266-2278.

+ Open protocol

+ Expand

STAT Transcription Factor Binding Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Breast cancer cells were grown to ~80% confluence and nuclear protein prepared using the Nuclear Extract Kit. STAT/DNA‐binding activity was detected by electrophoretic mobility shift assay (EMSA) using the EMSA Gel Shift kit (Panomics, Redwood City, CA, USA) according to the manufacturer's protocol. Briefly, the nuclear proteins were subjected to hybridization with a double‐stranded, biotin‐labelled oligonucleotide probe containing the consensus binding site for STAT1 (sense strand, 5′‐CATGTTATGCATATTCCTGTAAGTG‐3′) or STAT3 (sense strand, 5′‐CATGTTATGCATATTCCTGTAAGTG‐3′). The protein‐DNA complexes were resolved by 6% non‐denaturing PAGE, transferred to Pall Biodyne B nylon membrane (Pall Life Sciences, New Port Richey, FL, USA), and detected using streptavidin‐HRP and a chemiluminescent substrate.

Darvin P., Joung Y.H., Kang D.Y., Sp N., Byun H.J., Hwang T.S., Sasidharakurup H., Lee C.H., Cho K.H., Park K.D., Lee H.K, & Yang Y.M. (2016). Tannic acid inhibits EGFR/STAT1/3 and enhances p38/STAT1 signalling axis in breast cancer cells. Journal of Cellular and Molecular Medicine, 21(4), 720-734.

+ Open protocol

+ Expand

STAT3 Binding to GM-CSFRα Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nuclear extracts were prepared using an NE-PER Nuclear and Cytoplasmic Extraction kit (Thermo Scientific/Pierce). Two μg of nuclear protein extracts were incubated with biotin-labeled GM-CSFRα promoter DNA probes in binding buffer for 30 minutes on ice. All probes were synthesized by Sigma-Genosys. The sequences of the probes used are listed in Supplemental Table 2. Following incubation, the samples were separated on a 5% polyacrylamide gel in Tris-borate EDTA, transferred onto a nylon membrane, and fixed on the membrane by UV cross-linking. The biotin-labeled probe was detected with streptavidin horseradish peroxidase (EMSA Gel-Shift Kit, Affymetrix/Panomics). A 7-fold excess of unlabeled cold probes combined with biotin-labeled probes was used for competition control. To determine the effect of antibodies on protein-DNA binding, 1 μg of monoclonal mouse anti-human STAT3 (BD Biosciences; Cell Signaling Technology) or mouse anti-human phosphoserine STAT3 (Cell Signaling Technology) antibody was incubated with the nuclear extracts for 30 minutes on ice prior to adding the biotin-labeled DNA probe. The isotypic controls consisted of mouse Ig G1 (BD Biosciences).

Li P., Harris D., Liu Z., Rozovski U., Ferrajoli A., Wang Y., Bueso-Ramos C., Hazan-Halevy I., Grgurevic S., Wierda W., Burger J., O'Brien S., Faderl S., Keating M, & Estrov Z. (2014). STAT3-Activated GM-CSFRα Translocates to the Nucleus and Protects CLL Cells from Apoptosis. Molecular cancer research : MCR, 12(9), 1267-1282.

+ Open protocol

+ Expand

Quantification of Transcription Factor Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nuclear extracts were subjected to the EMSA “Gel Shift” Kit (Panomics) according to the manufacturer’s specifications. This assay enabled the simultaneous detection and semiquantitative comparison of the DNA-binding activity of NF-κB (5′-AGTTGAGGGGAC TTTCCCAGGC-3′), AP-1 (5′-GCCTTGATGACTCAG CCGGAA) and STAT-1 (5′-CATGTTATGCA TATTCCTGTA AGTG-3′) from nuclear extracts in mouse brain and primary cultured astrocytes. Biotin-labeled DNA-binding oligonucleotides were incubated with 10 mg of nuclear extract at 15 °C for 30 min to allow the formation of NF-κB/DNA, AP-1/DNA and STAT-1/DNA complexes. Complexes were separated from the free probes by 6% non-denaturing gel electrophoresis in 0.5× Tris/Borate/EDTA buffer (TBE) at 120V for 15 min. The probes in the complexes were then extracted, ethanol-precipitated, and hybridized to an EMSA “Gel Shift” Kit array. Signals were detected using SuperSignal (Thermo).

KIM J.Y., YENARI M.A, & LEE J.E. (2014). REGULATION OF INFLAMMATORY TRANSCRIPTION FACTORS BY HEAT SHOCK PROTEIN 70 IN PRIMARY CULTURED ASTROCYTES EXPOSED TO OXYGEN–GLUCOSE DEPRIVATION. Neuroscience, 286, 272-280.

+ Open protocol

+ Expand

Garlic Extract Modulates Cell Cycle Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols

Garlic extract was obtained from Egarak (Busan, Korea). Polyclonal antibodies against p-Cdc2 p34 (sc-12340-R), Cdc2 p34 (sc-54), CHK2 (sc-9064), Cdc25c (sc-327), p-Cdc25c (sc12354), p21WAF1 (sc-756), p53 (sc-126), Cyclin A (sc-751), Cyclin B1 (sc-245), p-ATM (sc-47739), ATM (sc-23921), WEE1 (sc-325), HSPA6 (sc-374589) and GAPDH (sc-20357) were obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Polyclonal antibodies against CHK1 (2360), p-CHK1 (2341), p-CHK2 (2661), ERK (9102), p-ERK (9101), JNK (9258), p-JNK (9251), p38 MAP kinase (9212), p-p38 MAP kinase (9211), AKT (9272), and p-AKT (9271) were obtained from Cell Signaling Technology Inc. (Danvers, MA, USA). Goat anti-rabbit IgG-horseradish peroxidase (HRP) (sc-2004), goat anti-mouse IgG-HRP (sc-2005), and donkey anti-goat IgG-HRP (sc-2020) were purchased from Santa Cruz Biotechnology Inc. Western Lightning Plus-ECL was obtained from PerkinElmer, Inc. (PerkinElmer, MA, USA). U0126, SB203580, SP600125, and wortmannin, were obtained from Calbiochem (San Diego, CA). A Nuclear Extract kit and EMSA Gel Shift kit were obtained from Panomics (Fremont, CA, USA). HSPA6 cDNA was obtained from the Korea human gene bank.

Shin S.S., Song J.H., Hwang B., Noh D.H., Park S.L., Kim W.T., Park S.S., Kim W.J, & Moon S.K. (2017). HSPA6 augments garlic extract-induced inhibition of proliferation, migration, and invasion of bladder cancer EJ cells; Implication for cell cycle dysregulation, signaling pathway alteration, and transcription factor-associated MMP-9 regulation. PLoS ONE, 12(2), e0171860.

+ Open protocol

+ Expand

NF-κB Transcription Factor Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Electrophoretic mobility shift assay was performed by using EMSA “gel shift” kit (Panomics, Redwood City, CA) according to the manufacturer's protocol. NF-κB consensus oligonucleotide probe (5′-AGTTGAGGGGACTTTCCCAGGC-3′) was used. Nuclear extract (3 µg) of cells was incubated with poly d(I–C) at room temperature for 5 min. The nuclear extract was then incubated with biotin-labeled probes and the incubated at room temperature for 30 min. After electrophoresis on a 6% polyacrylamide gel, the samples on gel were transferred onto a presoaked Immobilon-Ny + membrane (Millipore, Billerica, MA). The membrane was baked at 80°C for 1 h, cross-linked in an oven for 3 min and then developed by adding the blocking buffer and streptavidin–horseradish peroxidase conjugate.

Chen J.C., Yang S.T., Lin C.Y., Hsu C.J., Tsai C.H., Su J.L, & Tang C.H. (2014). BMP-7 Enhances Cell Migration and αvβ3 Integrin Expression via a c-Src-Dependent Pathway in Human Chondrosarcoma Cells. PLoS ONE, 9(11), e112636.

+ Open protocol

+ Expand

EMSA Protocol for Analyzing AP-1 Transcription Factor

Check if the same lab product or an alternative is used in the 5 most similar protocols

EMSA was performed using an EMSA gel-shift kit (Panomics, Santa Clara, CA) as previously described with some modifications [26 (link)]. Briefly, after HUVECs were washed with cold PBS and scraped, the cell pellets were collected by centrifugation. The NucBuster protein extraction kit (Novagen, Madison, WI) was used to extract nuclear protein from HUVECs. Nuclear extracts were incubated with the biotin-labeled activator protein (AP)-1 consensus probe (5’-CGCTTGATGACTCAGCCGGAA-3’) at room temperature for 30 min. The protein-DNA complexes were separated by electrophoresis on a 6% DNA retardation gel (Invitrogen, Carlsbad, CA), and electronically transferred to nylon membrane. For chemiluminescence band detection, the membrane was incubated with horseradish peroxidase-streptavidin solution and chemiluminescence reagent. The intensities of the blots were analyzed using a ChemiDoc Touch Imaging System (Bio-Rad, Hercules, CA).

Umebashi K., Tokito A., Yamamoto M, & Jougasaki M. (2018). Interleukin-33 induces interleukin-8 expression via JNK/c-Jun/AP-1 pathway in human umbilical vein endothelial cells. PLoS ONE, 13(1), e0191659.

+ Open protocol

+ Expand

Nuclear Extraction and EMSA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nuclear extracts were prepared as reported (Marquardt et al., 2012 ). Briefly, homogenized tissue was resuspended in Igepal CA-630 (0.58%) in 10 mM Hepes, pH 7.9, containing 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM Dithithreitol (DTT), and 0.5 mM PMSF. Nuclei were pelleted in 20 mM Hepes, pH 7.9, containing 0.4 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, and 1 mM PMSF. After mixing for 15 min at 4 °C, samples were centrifuged at 13,000g for 5 min, and the supernatants were recovered. Protein content was assayed by BCA kit (Pierce). NF-κB and Nrf2 DNA binding activities were assayed using the EMSA “Gel shift ”kit (Panomics), probing 10 μg of nuclear protein with both biotinylated NFκB-p65 consensus oligonucleotide 5′ CATCGGAAATTTCCGGAAATTTCCGGAAATTTCCGGC 3′, and Nrf2 consensus oligonucleotide 5′ GCTCTTCCGGTGCTCTTCCGGT 3′. The complexes were electrophoresed on 6% polyacrilamide native gels and transferred to a positively charged nylon membrane, 0.45 μm pore size (Schleicher and Schuell, Keene, NH). Detection was performed using the streptavidin-horseradish peroxidase conjugated. All procedure was performed according the manufacturer's instructions.

Gomez-Quiroz L.E., Seo D., Lee Y.H., Kitade M., Gaiser T., Gillen M., Lee S.B., Gutierrez-Ruiz M.C., Conner E.A., Factor V.M., Thorgeirsson S.S, & Marquardt J.U. (2016). Loss of c-Met signaling sensitizes hepatocytes to lipotoxicity and induces cholestatic liver damage by aggravating oxidative stress. Toxicology, 361-362, 39-48.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!