Miscript mirna pcr array

Cultured rat cortical neurons treated with or without glycine (100 μM) for 24 h were collected for miRNA microarray analysis. Total RNAs were isolated using TRIzol reagent (Invitrogen, USA) and a miRNeasy Mini Kit (QIAGEN, Germany). RNA samples were applied to the miScript miRNA PCR Arrays (QIAGEN, Germany). Expression profiling was done with dissociation curves using ABI QuantStudio 6 K Flex (ABI, USA). 500 ng RNA template, miScript Reverse Transcriptase Mix (2 μl), 5× miScript HiSpec Buffer (4 μl), 10× miScript Nucleics Mix (2 μl) added into RNase-free water to the volume of 20 μl. Reverse transcription reactions were incubated at 37 °C (60 min) followed by at 95 °C (5 min). The qPCR reactions were consisted of cDNA template (0.8 μl), 2× QuantiTect SYBR Green PCR Master Mix (12.5 μl), 10× miScript Universal Primer (2.5 μl), added into RNase-free water to the volume of 25 μl. Reactions were incubated at 95 °C (15 min), followed by 40 cycles at 94 °C (15 s), 55 °C (30 s) and 70 °C (30 s), followed by melting curve ananlysis. Fold changes in miRNA expression were calculated using the comparative Ct method and normalized to U6 small nuclear RNA (snRNA) as endogenous control. After normalization, differentially expressed miRNAs were identified through Fold Change filtering.

Total RNA containing miRNAs was extracted through the mirVana miRNA Isolation kit (Thermo Fisher, USA), and miScript II RT Kit (Qiagen) was used for reverse transcription of total RNA containing miRNA. A PCR primer assay was performed using the QuantiTect SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) and gene-specific primers that attached to the bottom of the mouse inflammatory response and autoimmunity-based miScript miRNA PCR arrays (Qiagen) in the ABI 7500 Fast System (Thermo Fisher). PCR primer assay data were analysed on the Qiagen analysis website (www.qiagen.com/us/shop/genes-and-pathways/)and a scatter plot result was the output.

To analysis miRNA expression, RT-qPCR was conducted on a C1000™ Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA) using an miScript SYBR Green PCR Kit with miScript miRNA PCR Arrays (Qiagen). Gene expression levels were normalized to miRTC expression levels for the corresponding miRNA samples. The following target miRNAs were quantified by miScript Primer assays (Qiagen), rno-miR-16-5p (cat no. MS00033229; mature miRNA with the sequence UAGCAGCACGUAAAUAUUGGCG), and miRTC (MS00000001). cDNA was synthesized from 500 ng of total RNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan). Quantitative RT-PCR was performed using SYBG Green Real-time PCR Master Mix (Toyobo). Gene expression levels were normalized with beta-2 microglobulin (B2M) mRNA expression levels of corresponding cDNA samples. All PCR primers were purchased from Bioneer (Daejeon, Korea). The following primers were used: rARRB1 (Forward 5′-ACCTGGATGTCTTGGGTCTG-3′ -Reverse 3’-TAGCCGAGTCAGTGGCTTCT-5′, hSSTR2 (forward 5′-TGAGAAGAAGGTCACCCGAAT-3′, reverse 3′-AGGACCACCACAAAGTCAAAC-′) and hB2M (forward ′-TTACTCACGTCATCCAGCAGA-3′, reverse 3’-AGAAAGACCAGTCCTTGCTGA-′).

For miRNA array, total RNA was isolated from My5 cells with miRNeasy Mini kit (QIAGEN). Reverse transcription was performed with miScript II RT kit (QIAGEN), according to the protocol provided by QIAGEN. Quantitative analysis of miRNA was performed with miScript SYBR Green PCR Kit (QIAGEN) and miScript miRNA PCR Arrays (QIAGEN), performed with our Applied Biosystems 7900HT Fast Real-Time PCR System, according to the protocol provided by the manufacturer. Data analyses were performed with QIAGEN online software. The miRNA array data presented in this manuscript have been deposited in the NCBI GEO database (accession no. GSE61693).
For qPCR, total RNA was used to do qPCR with either CRBN primers (forward: 5’-CAGTCTGCCGACATCACATAC; reverse: 5’-GCACCATACTGACTTCTTGAGGG) or AGO2 primers (forward: 5’-TCCACCTAGACCCGACTTTGG; reverse: 5’-GTGTTCCACGATTTCCCTGTT).

miRNeasy Serum/Plasma Spike-in Control (Caenorhabditis elegans miR-39 miRNA mimic) (QI-AGEN Gmbh, Hilden, Germany) was added to each serum sample before RNA extraction (3.5 μL miRNeasy Serum/Plasma Spike-in Control per 100 μL serum sample) for monitoring miRNA purification and amplification. An amount of 300 μL of each serum sample was used for RNA extraction. Total RNA extraction from blood serum samples was performed using TRIzol LS (ThermoFisher Scientific (Invitrogen), Waltham, MA, USA), according to the manufacturer’s instructions. The resulting RNA was dissolved into 30 μL of RNase-free water.
Subsequently these RNA samples were used for miScript miRNA PCR Arrays (QI-AGEN Gmbh, Hilden, Germany) and real time PCR (qRT-PCR).