Biometra thermocycler

Manufactured by Analytik Jena

Sourced in Germany, United States

The Biometra thermocycler is a laboratory instrument used for the amplification of DNA sequences through the process of PCR (Polymerase Chain Reaction). It precisely controls the temperature and duration of the various steps involved in the PCR process, enabling the exponential replication of targeted DNA fragments.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (3 mentions) Turbo dna free kit, by Thermo Fisher Scientific (2 mentions) Gel documentation system, by Analytik Jena (1 mentions) Miniprep kit, by Qiagen (1 mentions) E coli top10 cells, by Thermo Fisher Scientific (1 mentions) Primescript rt reagent kit, by Takara Bio (1 mentions) Mastercycler, by Eppendorf (1 mentions) First strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Rotor gene q, by Qiagen (1 mentions) High capacity reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Reaction buffer, by Thermo Fisher Scientific (1 mentions) Cfx software, by Bio-Rad (1 mentions) Revertaid h minus reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Tri reagent, by Merck Group (1 mentions) Cfx connect system, by Bio-Rad (1 mentions) Sybr green master mix, by Qiagen (1 mentions) Taq polymerase, by Merck Group (1 mentions) Quantitect reverse transcription kit, by Qiagen (1 mentions) Bigdye terminator cycle sequencing kit, by Thermo Fisher Scientific (1 mentions) Qiaquick gel extraction kit, by Qiagen (1 mentions)

Spelling variants of this product

Thermocycler (94 citations) Biometra T3000 Thermocycler (8 citations) Biometra TAdvanced thermocycler (6 citations) Biometra T Professional thermocycler (5 citations) Biometra TOptical Thermocycler (5 citations) Biometra TOne thermocycler (3 citations) Biometra T1 Thermocycler (3 citations) Biometra TPersonal Thermocycler (2 citations) Biometra personal thermocycler (2 citations) Biometra T professional Basic thermocycler (2 citations)

14 protocols using biometra thermocycler

PPRV Detection by One-Step RT-PCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Twenty two samples which were positive by sELISA were tested for PPRV nucleic acid by one step RT-PCR amplification. The test was carried out using primer set directed to the conserved partial sequence of Ngene: (NP3) (Forward:5-TCTCGGAAATCGCCTCACAGACTG-3) and (NP4)(Reverse:5-CCTCCTCCTGGTCCTCCAGAATCT-3) [18 ]. RT-PCR for Ngene was carried out at 45 °C for 15 min to activate transcriptase enzyme. Initial denaturation was performed at 95 °C for 10 min, followed by 35 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, and a final extension step was performed at 72 °C for 10 min. For Fgene RT-PCR, 16 samples were selected from Ngene based RT-PCR positive samples using a primer set directed to the Fgene of PPRV: f1b (Forward:5-AGTACAAAAGATTGCTGATCACAGT-3) and f2d (Reverse:5-GGGTCTCGAAGGCTAGGCCCGAATA-3) [19 (link)]. RT-PCR for Fgene was carried out at 45 °C for 15 min to activate transcriptase enzyme, 95 °C for15 min as initial denaturation followed by35cycles of 95 °C for 1 min, 50 °C for1 min, and 72 °C for 2 min, and a final extension step was performed at 72 °C for 7 min using Biometra Thermocycler (Analytik Jena, Germany).
PCR products were subjected to electrophoresis in 2% agarose gel stained with ethidium bromide and visualized under ultraviolet (UV) light using a gel documentation system (Analytik Jena, Germany).

Saeed F.A., M.Gumaa M., A.Abdelaziz S., Enan K.A., Ahmed S.K, & Hussien M.O. (2021). Epidemiology and molecular characterization of re-emerged virulent strains of Peste des Petits Ruminants virus among sheep in Kassala State, Eastern Sudan. Irish Veterinary Journal, 74, 23.

+ Open protocol

+ Expand

Modular Assembly of Plasmid Constructs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The KanR^1–118 + SGY
and SSS + KanR^119–271 regions from the previously
constructed pSiMPl^k_N and pSiMPl^k_C plasmids^{1 (link)} were removed by performing PCR separately using
primer pairs Gib_SiMPl_BB1_FP and Gib_SiMPl_BB1_RP and Gib_SiMPl_BB2_FP
and Gib_SiMPl_BB2_RP, respectively. The complete list of primers used
in the present study is given in the Supporting Information. All PCR amplifications were performed with Phusion
Flash High-Fidelity PCR Master Mix (2×) from ThermoScientific
using a Biometra-Thermocycler from Analytik Jena. The N- and C-terminal
fragments of the resistance genes were amplified separately using
the appropriate primer pairs (Supporting Information). These primer pairs were designed to have overlapping sequences
at the 5′ end with the respective plasmid backbones. Plasmids
were finally assembled by Gibson Assembly. Chemically competent E. coli TOP10 cells (Invitrogen) were used for all
cloning purposes. For selection, kanamycin, chloramphenicol, ampicillin,
hygromycin, spectinomycin, and streptomycin were used at final concentrations
50, 35, 100, 100, 50, and 50 μg/mL, respectively. Plasmid isolation
was performed using the Miniprep kit from Qiagen. Sanger sequencing
of the plasmids was done at GATC (Eurofins Genomics).

Palanisamy N., Ballestin J.B, & Di Ventura B. (2021). Expanding the SiMPl Plasmid Toolbox for Use with Spectinomycin/Streptomycin. ACS Omega, 6(22), 14148-14153.

+ Open protocol

+ Expand

Extraction and Quantification of RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the RNeasy MiniKit QIAGEN according to the manufacturer’s protocol (Invitrogen, Basel, Switzerland). The cDNA were produced by reverse transcribed 500 ng of extracted RNA using PrimeScript RT reagent Kit (Takara Bio USA, Mountain View, CA, USA). PCR reaction reactions were performed in a Biometra thermocycler (Analytik Jena, Göttingen, Germany), with allTaq polymerase mix (Quiagen, Hombrechtikon, Switzerland), 250 nM primers and 1 μL of cDNA. The primer sequences used for qRT-PCR are listed in Table 1 below.

Locatelli M., Delhaes F., Cherpin O., Black M.E., Carnesecchi S., Preynat-Seauve O., Hibaoui Y, & Krause K.H. (2022). Optimization of Thymidine Kinase-Based Safety Switch for Neural Cell Therapy. Cells, 11(3), 502.

+ Open protocol

+ Expand

Bacterial Identification via 16S rRNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sequences of the primers used for PCR and the used PCR conditions are reported in Table S1 of Supplementary Material. PCR reactions were performed in a Biometra thermocycler (Analytik Jena, Germany) or Eppendorf Mastercycler (Eppendorf, Germany) apparatus. PCR products were visualized after agarose gel electrophoresis (1.5%) in Tris-acetate/EDTA buffer (90 V for 1 h) using GelRed. DGGE was performed in a C.B.S scientific apparatus (Del Mar, CA) as described (Moreels et al. 2004; Lerner et al. 2020) . Pictures of DGGE profiles were edited using BioNumerics v7.6.3 (Applied Maths NV, St-Martens-Latem, Belgium).
Sanger sequencing of 16S rRNA gene amplicons 16S rRNA gene amplicons were obtained from pure cultures of two isolates using primer set 27F and 1492R according to the described PCR conditions (Table S1) and sequenced on a Sanger platform using primer 1492R (GATC Biotech AG, Germany), recovering partial 16S rRNA gene sequences of around 1000 bps. Sequence similarity was determined using NCBI Blast (Morgulis et al. 2008) .
Maximum likelihood phylograms of relevant 16S rRNA gene sequences were obtained after alignment using Muscle v3.8.31 (Edgar 2004 ) and implementing a 1000x bootstrap analysis using RAxML v.8.2. (Stamatakis 2014) .

Lerner H., Öztürk B., Dohrmann A.B., Thomas J., Marchal K., De Mot R., Dehaen W., Tebbe C.C, & Springael D. (2021). DNA-SIP and repeated isolation corroborate Variovorax as a key organism in maintaining the genetic memory for linuron biodegradation in an agricultural soil. FEMS microbiology ecology, 97(5).

+ Open protocol

+ Expand

RT-qPCR Analysis of MIF Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

To transcribe the purified RNA into single stranded cDNA, the First Strand cDNA synthesis kit (Thermo Fisher Scientific) was used according to the manufacturer´s protocol. Briefly, a reaction mix containing 1 µl RNase inhibitor, 2 µl dNTP mix, 2 µl reverse transcriptase,1 µl Oligo(dT)18 primers and 4 µl 5 x reaction buffer was prepared and mixed with 1 µg of isolated RNA. The reverse transcription was performed in a Biometra thermocycler (Analytik Jena AG, Jena, Germany) with following incubation settings: 1 h at 37°C, 5 min at 70°C, cooling down to 4°C. RT-qPCR was performed using ORA TM SEE qPCR Green ROX H Mix (HighQu, Kraichtal, Germany) and specific mouse primer pairs (Eurofins, Ebersberg, Germany). The following primers were used: MIF forward: ACA GCA TCG GCA AGA TCG and MIF reverse: AGG CCA CAC AGC AGC TTA C; actin forward: GGA GGG GGT TGA GGT GTT and actin reverse: GTG TGC ACT TTT ATT GGT CTC AA. PCR reactions were run in a Rotorgene Q (Qiagen). Relative mRNA levels were calculated using the ΔΔCt method with actin as a housekeeping gene.

Krammer C., Yang B., Reichl S., Bolini V., Schulte C., Noels H., Bounkari O.E., Kapurniotu A., Weber C., Mohanta S.K., & Bernhagen J. (2021). Link between aging and atheroprotection in Mif-deficient atherosclerotic mice.

+ Open protocol

+ Expand

Reverse Transcription and cDNA Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Reverse transcription was performed according to the kit manufacturer's protocol (High Capacity Reverse Transcription kit; Applied Biosystems). A no template control reaction and RT-free reactions were prepared as blank and negative controls. Each 20 µl reaction included: 10 × reverse transcription buffer (2 µl), 100 mM deoxyribonucleotide triphosphate (dNTP) mix (0•8 µl), 10 µM random primers (1•5 µl), 10 µM oligo dT primers (0•5 µl), RT (1•0 µl), 2 µg of total RNA as template and nucleasefree water to make up the volume. RNA was denatured at 95°C for 10 min before addition of master mix containing all other reagents. Reverse transcription was performed on a Biometra Thermocycler (Analytik Jena) using the following programme: 25°C for 10 min, 37°C for 120 min, 85°C for 5 min and then terminated at 4°C. A pool of cDNA samples was created for serial dilutions, calibrator samples and primer validations. Samples of cDNA were diluted 20-fold with nuclease-free water as template for quantitative real time PCR (qPCR), and stored at -20°C.

Houston S.J.S., Karalazos V., Tinsley J., Betancor M.B., Martin S.A.M., Tocher D.R, & Monroig O. (2017). The compositional and metabolic responses of gilthead seabream (Sparus aurata) to a gradient of dietary fish oil and associated n-3 long-chain PUFA content. The British journal of nutrition, 118(12).

+ Open protocol

+ Expand

Quantitative RT-qPCR Analysis of Myogenic Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cultured cells grown either in 100 or in 35-mm dishes using Tri-reagent (Sigma-Aldrich) or RNeasy Mini kit (74104, Qiagen). The RNA quality was verified by agarose gel. Reverse transcriptase was performed on mRNA using 5× reaction buffer (Thermo Fisher Scientific), RevertAid H Minus Reverse Transcriptase (EP0451, Thermo Fisher Scientific), and random hexamer (Eurogentec) and Biometra thermocycler. RT-qPCR reaction using SYBR Green Mastermix (Qiagen) in the CFX-connect system (Bio-Rad) was performed on the cDNA using the oligonucleotides (sens/antisens) myogenin (CAATGCACTGGAGTTCGGTC /ACAATCTCAGTTGGGCATGG), hrs (GACAAGCTGGCACAGATACG/CTCTGCACCTCCAGGTACTC), mef2A (CAGCATTCCAGGGGAAGTAA/AATCAAAGGATAAGC), and cyclosporine B (AACTTTGCCGAAAACCACAT/GATGGCACAGGAGGAAAGAG).
The relative levels of mRNAs were calculated with the second derivative method (2^−(ΔΔCt) equation) and normalized to cyclosporine B expression with the Bio-Rad CFX software.

Coudert L., Osseni A., Gangloff Y.G., Schaeffer L, & Leblanc P. (2021). The ESCRT-0 subcomplex component Hrs/Hgs is a master regulator of myogenesis via modulation of signaling and degradation pathways. BMC Biology, 19, 153.

+ Open protocol

+ Expand

Molecular Detection of Antibiotic Resistance

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCRs were perfomed on a Biometra thermocycler (Biometra, USA). All reactions were performed in a 25 μl volume containing: 10 mM Tris/HCl (pH 8.3), 50 mM KCl, 1.25 mM MgCl2, 100 μM each dATP, dCTP, dGTP and dTTP, 1 μM each oligonucleotide primer, 1 U Taq polymerase (Sigma-Aldrich) and 200 ng template DNA. All strains were investigated for the presence of mecA[19 (link)]; tet(K) and tet(M)[20 (link)]; erm(A), erm(B), erm(C), msr(A)[19 (link)]; and aac(6′)–aph(2″) genes [19 (link)]. PCR products were analysed in agarose gel (1.5%) electrophoresis in 1X Tris-borate-EDTA buffer (TBE) at pH 8.3. Electrophoresis was carried out with an appropriate molecular ladder to determine fragment sizes.

Vitali L.A., Petrelli D., Lamikanra A., Prenna M, & Akinkunmi E.O. (2014). Diversity of antibiotic resistance genes and staphylococcal cassette chromosome mec elements in faecal isolates of coagulase-negative staphylococci from Nigeria. BMC Microbiology, 14, 106.

+ Open protocol

+ Expand

Isolating and Sequencing MRO Splice Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from GCs and CCs using the RNeasy Mini kit (Qiagen Inc., Toronto, ON, Canada). TURBO DNA-free kit (ThermoFisher) was used to ensure removal of genomic DNA. Commercial total RNA from human tissues (testes—pooled from 39 Caucasians, ages: 14–64; liver—Caucasian male, age: 51; kidney—Caucasian female, age: 40; ovary—pooled from 16 Caucasian, ages: 20–60) (Takara Bio USA Inc., Mountain View, CA, USA) and H68 cell line (Life Technologies, Carlsbad, CA, USA). The cDNA was prepared from 1 ug of total RNA using the QuantiTect Reverse Transcription Kit (Qiagen). PCR amplification was performed with the QuickLoad Taq enzyme mix (New England Biolabs (NEB), Ipswich, MA, USA), using the Biometra thermocycler (Biometra, Goettingen, Germany). To clone the MRO splice variants, 4 primer pairs were designed (Table 2) using Primer3 software [18 (link)]. PCR products were resolved on 2% agarose gels and visualized on the MiniBis gel documentation system (DNR, Kiryat-Anavim, Israel).
The PCR products were cloned into Cloning into pGEM-Teasy vector (S1 File) and successful ligation was confirmed by sequencing at the Centre of Applied Genomics–TCAG (Hospital for Sick Children, Toronto, ON, Canada). Sequencing files can be found in Kenigsberg, Shlomit (2017): MRO clones sequence files. Figshare. https://doi.org/10.6084/m9.figshare.4779763.v1

Kenigsberg S., Lima P.D., Maghen L., Wyse B.A., Lackan C., Cheung A.N., Tsang B.K, & Librach C.L. (2017). The elusive MAESTRO gene: Its human reproductive tissue-specific expression pattern. PLoS ONE, 12(4), e0174873.

+ Open protocol

+ Expand

RAPD Analysis of Bacterial Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was isolated from parent strain and its mutants by a procedure described in [13 (link)]. RAPD amplification was performed in a buffer (50 μL) which contained 5 μL of 10x PCR buffer, 3 μL of MgCl₂ (25 mM), 1 μL of dNTP mixture (2.5 mM), 5 U of Taq DNA polymerase, 25 ng of template DNA, 2 μL of primer (Table 1), and 36 μL of ddH₂O. All these reagents were purchased from Takara (Japan). Amplification was run in a Biometra thermocycler (Biometra, Germany) set at the following program: 95°C for 5 min, followed by 45 cycles of 95°C for 30 s, 36°C for 1 min, and 72°C for 2 min. After that, a 10 min final extension at 72°C was conducted to stabilize the amplified DNA products. Such amplified products were separated by electrophoresis in 1.0% agarose gel and visualization in a UV transilluminator.

Huang J., Chen D., Wei Y., Wang Q., Li Z., Chen Y, & Huang R. (2014). Direct Ethanol Production from Lignocellulosic Sugars and Sugarcane Bagasse by a Recombinant Trichoderma reesei Strain HJ48. The Scientific World Journal, 2014, 798683.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!