The wild-type cyiPSC line 1123C1 was previously described.20 (link) cyiPSCs were maintained in AK-02N medium (Ajinomoto).
CRISPR-Cas9 constructs were designed based on a previous report.21 (link) To inactivate B2M, we aimed at disrupting exon 2 of the cynomolgus monkey B2M gene. The guide RNA sequence was UAUGUUCCUCAGGUACUCCA, which corresponds to the sequence at the 5′-end of exon 2 (Fig. 1A ). The guide oligo DNAs (Table 1 ) corresponding to the guide RNA sequence were annealed and ligated to pSpCas9(BB)-2A-Puro.21 (link)BbsI was then used to digest pSpCas9(BB)-2A-Puro. DNA vectors (3.3 μg) encoding the guide RNA for B2M and Cas9 were introduced into 1.0 × 106 cyiPSCs in 100 μL OPTI-MEM by a nucleofection system following the manufacturer's instructions (Nepa21, Nepa Gene). Electric pulses (175 V, 5 ms) were used. Two days after the nucleofection, the cells were cultured with puromycin. Eight days after the nucleofection, 39 colonies were picked up, and the cells in each colony were expanded. Genomic DNAs were extracted from the cells and subjected to polymerase chain reaction (PCR) analysis.
CRISPR-Cas9 constructs were designed based on a previous report.21 (link) To inactivate B2M, we aimed at disrupting exon 2 of the cynomolgus monkey B2M gene. The guide RNA sequence was UAUGUUCCUCAGGUACUCCA, which corresponds to the sequence at the 5′-end of exon 2 (