The HAw/pCI, K3/pCI and GK/pCI plasmids were used for DNA vaccination. The HAw/pCI plasmid contains the nucleotide sequence identical to the region encoding the full-length HA from A/swan/Poland/305-135V08/2006 (H5N1). The K3/pCI and GK/pCI plasmids contain two different nucleotide sequences encoding the same H5 HA protein as HAw/pCI (with the leader peptide) but without the proteolytic cleavage site (341-RRRKKRR-347) between HA1 and HA2 subunits. The sequence encoding HA, present in K3/pCI, was optimized for domestic chicken (Gallus gallus) and the codon adaptation index (CAI) reached 0.91. In contrast, the sequence encoding HA, present in GK/pCI was not optimized to any codon bias but it was was modified by changing the nucleotides present in the third positions of the codons to either guanine (G) or cytosine (C). The cDNA of K3 and GK were synthesized by GeneScript (USA; http://www.genscript.com/ ). Comparison of the HA sequences is shown in Additional file 2 : Figure S2. The inserts were cloned into MluI and SalI restriction sites of the pCI expression vector (Promega, Wisconsin, USA) downstream of the cytomegalovirus (CMV) promoter and upstream of the SV40 late polyadenylation signal. Plasmids were propagated in DH5α strain of Escherichia coli and isolated using NucleoBond® PC 10000 EF Giga-scale purification kit (Macherey-Nagel, Düren, Germany).
Pci expression vector
Manufactured by Promega
Sourced in United States, United Kingdom
The PCI expression vector is a plasmid designed for the expression of recombinant proteins in mammalian cell lines. It contains the cytomegalovirus (CMV) promoter for high-level gene expression and the neomycin resistance gene for selection of stable transfectants.
Automatically generated - may contain errors
Lab products found in correlation
Phusion polymerase, by Thermo Fisher Scientific (2 mentions)
3100 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Geneart, by Thermo Fisher Scientific (1 mentions)
Dh5α competent cells, by Thermo Fisher Scientific (1 mentions)
P3xflag cmv 10 vector, by Merck Group (1 mentions)
Zyppy plasmid maxiprep kit, by Zymo Research (1 mentions)
Pfuultra 2 fusion hs dna polymerase, by Agilent Technologies (1 mentions)
Forward and reverse primer, by Integrated DNA Technologies (1 mentions)
5 protocols using pci expression vector
1
Optimized DNA Vaccines for Influenza H5N1
2
Amplification and Cloning of ORs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The open reading frames of ORs were amplified using Phusion polymerase (Thermo Fisher Scientific). Amplified fragments were cloned into pCI expression vector (Promega) containing the sequence encoding the first 20 amino acids of human rhodopsin (Rho-tag) at the N-terminal30 (link). The cDNA of Ces1d was amplified using Phusion polymerase from the cDNA library of mouse olfactory epithelium and cloned into pCI expression vector without any tag. The sequences of the cloned receptors were verified by sequencing (3100 Genetic Analyzer, Applied Biosystems).
3
Synthesis and Characterization of Fluorescent α7 nAChR Subunits
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type human α7 nAChR subunits were synthesized by GeneArt (ThermoFisher, UK). The sequence of the cDNA was optimized for expression in mammalian cells. Fluorescently tagged α7 nAChR subunits were produced by inserting mCherry cDNA into the M3-M4 cytoplasmic loop of α7 at amino acid 391 (α7-mCherry).The positioning of the tag has previously been demonstrated to retain the functional properties of the receptor [45 (link)] and sits 74 amino acids away from the MX helix, which is proposed to be the site of interaction between RIC3 and α7 [46 (link), 47 (link)]. Both wild-type and fluorescent α7 nAChR subunit cDNAs were subcloned into the pCI expression vector (Promega, UK).
4
Cloning and Engineering Mouse β-Catenin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse β-catenin full-length cDNA was cloned by PCR from an adult mouse brain cDNA library using high proof PfuUltra II Fusion HS DNA Polymerase (Agilent) according to the manufacturer protocol, using the following primer pair: 5' CTAGCTAGCTAGATGGATACGTATCGCTACATAATGGCTACTCAAGC 3' and 5' TGCTCTAGAGCATTACAGGTCAGTATCAAACCAGGCCAGCTGATT 3'. Purified β-catenin cDNA fragments were subcloned into a PCI expression vector (Promega) and transformed into DH5α competent cells (Invitrogen). PCI-β-catenin plasmids were purified using the Zyppy Plasmid Maxiprep Kit (Zymo Research) and PCR site-directed mutagenesis of β-catenin (β-catenin Y142F) performed according to a published strategy (Zheng et al., 2004 (link)) using the following primer pair: 5' GTTGTCAATTTGATTAACTTCCAGGATGACGCGGAACTTG 3' and 5' CAAGTTCCGCGTCATCCTGGAAGTTAATCAAATTGACAAC 3'. The β-catenin and β-catenin Y142F fragments were PCR amplified using the following primer pair: 5' CGGGATCCATGGATACGTATCGCTACATAATGGCTACTCAAGC 3' and 5' CGGGATCCTTACAGGTCAGTATCAAACCAGGCCAGCTGATT 3'.
The purified fragments were subcloned into a p3XFLAG-CMV-10 vector (Sigma-Aldrich) to generate p3XFLAG-CMV-10-β-catenin and p3XFLAG-CMV-10-β-cateninY142F plasmids. The fidelity of the entire coding sequences of all plasmids was confirmed by DNA sequencing (Genewiz).
The purified fragments were subcloned into a p3XFLAG-CMV-10 vector (Sigma-Aldrich) to generate p3XFLAG-CMV-10-β-catenin and p3XFLAG-CMV-10-β-cateninY142F plasmids. The fidelity of the entire coding sequences of all plasmids was confirmed by DNA sequencing (Genewiz).
5
Site-Directed Mutagenesis of Olfactory Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single-site mutations were performed as described previously (Bushdid et al., 2018) . Briefly, forward and reverse primers coding for the mutation were obtained from Integrated DNA Technologies. Phusion polymerase (Thermo Fisher Scientific) was used for polymerase chain reaction (PCR) to amplify receptors with mutations. Two rounds of PCR were performed. The first round generated two fragments, one containing the 5′ region upstream of the mutation site and the other the 3′ downstream region. The second PCR amplification round joined these two fragments resulting in full open reading frame of the OR51E2. Thus obtained PCR products were then gel purified and cloned into pCI expression vector (Promega) that contains Rho-tag. All mutants had a Rho tag at their N-terminus to facilitate cell surface expression by florescent labeling. Plasmids were purified using a miniprep kit from Thomas Scientific (1158P42) and verified by DNA sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!