RNA was extracted from the forming epithelia of molar, cuticle, basal segment, and mandible tissues, as well as from the hepatopancreas, muscle and testis, using EZ-RNA Total RNA Isolation Kit (Biological Industries, Beit Haemek, Israel), according to the manufacturer’s protocol. First strand cDNA was generated with oligo (dT) 22 VN using expand RT (Roche, Basel, Switzerland). PCR was performed with the Cq-M13F (5'-gggcgagccaggtgactatggacc-3' ) and Cq-M13R (5'- ccaccctttgtttgcgaccgtcg-3' ) primers. 18S rRNA was evaluated as described previously [25 (link)]. Cq-M13 was amplified by means of PCR with REDTaq ReadyMix PCR Reaction Mix (Sigma); using specific conditions: 94°C for 1 min, followed by 30 cycles of 94°C for 1 min, 60°C for 2 min, 72°C for3 min, followed by 10 min at 72°C).
Expand rt
Manufactured by Roche
Expand RT is a reverse transcriptase enzyme used for the conversion of RNA into complementary DNA (cDNA) during the process of reverse transcription. This enzyme catalyzes the synthesis of single-stranded cDNA from an RNA template.
Automatically generated - may contain errors
Lab products found in correlation
Tri reagent, by Merck Group (2 mentions)
Sybr green kit, by Roche (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Redtaq readymix pcr reaction mix, by Merck Group (1 mentions)
Ez rna total rna isolation kit, by Sartorius (1 mentions)
Thermopol buffer, by New England Biolabs (1 mentions)
Thermopol taq polymerase, by New England Biolabs (1 mentions)
Dntps, by Promega (1 mentions)
Rq1 dnase, by Promega (1 mentions)
Rnaseout, by Thermo Fisher Scientific (1 mentions)
Abi prism 3100, by Thermo Fisher Scientific (1 mentions)
6 protocols using expand rt
1
Quantitative Transcriptional Analysis of Cq-M13
2
RNA Extraction and Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA extraction, cells at different pre-selected time-points were collected after trypsinization, and resuspended in TRI-reagent (Sigma) after washing with 1X PBS. RNA was extracted as per manufacturer’s protocol and resuspended in RNA grade water and quantified by NanoDrop (Thermo scientific). To remove any residual genomic DNA, DNase treatment was applied after RNA extraction using 200U of DNase enzyme (Roche) as per their protocol. To analyze gene expression, the extracted RNA was then reverse transcribed to cDNA using Expand RT (Roche) according to their protocol with random primers. Polymerase chain reaction was performed by gene-specific primers and cDNA as template. PCR reaction was consisted of 1X Thermopol buffer (NEB), 25 μM forward primer, 25 μM reverse primers, 250 mM dNTPs (Promega) and Thermopol Taq Polymerase (0.5 U/μl; NEB). PCR machine was programmed for: 3 min at 95°C, 40 cycles of 95°C for 30 s, 60–64°C annealing temperature depending on the primer for 30 s, 30 s at 72°C; and a final extension step of 72°C for 5 min.
3
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated (AbsolutelyRNA kit; Stratagene) and first-strand cDNA generated with random nonamers using Expand RT (Roche). QPCR was performed using Power SYBR® Green PCR Master Mix reagents (ABI) on an ABI 7500 instrument. Samples were quantified with a standard curve and were normalized for HPRT expression. Primer sequences are shown in S1 Table .
4
HIV-1 Viral RNA and DNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
293T cells were cotransfected with pNL4-3Δenv (WT or ΔZF2) and pNL4-3MA-YFP-Δenv (WT or ΔZF2) plasmids (4 μg of each plasmid) and complemented with pENX plasmid (2 μg) by the calcium phosphate precipitation method in a T75 flask. The supernatant was harvested 20 h after transfection and virions were purified by ultracentrifugation through a 20% sucrose cushion to extract viral RNA and DNA. DNA was extracted from cells with DNAzol (MRC). Viral RNAs were reverse transcribed using an oligo(dT) primer with the Expand RT (Roche). A control experiment was systematically performed without RT to control the absence of DNA contamination. Full-length RNA (FL) and multispliced cDNA forms (MS) corresponding to the RTion of the spliced viral RNAs were amplified with the SYBR Green kit (Roche) using the RotorGene (Labgene) system. A standard curve was generated from 103 to 106 copies of pNL4-3 plasmid. The amount of viral MS-DNA was normalized to the GAPDH DNA level. In RNA interference experiments, 293T cells were cotransfected with Tsg101 siRNA (Tsg101-6Flexitube siRNA, Qiagen) or negative control siRNA duplex (Eurogentec) and the pNL4-3Δenv plasmid (2 μg) by lipofectamine in a 6-well plate. Cell lysates were harvested after 48 h. Gag and endogenous Tsg101 levels were analyzed by western blotting (Text S7) and DNA was extracted from cells and analyzed by qPCR as described above.
5
Quantification of Viral RNA and DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One aliquot of nucleic acids extracted from virions was saved to quantitate gRNA. To this end, RNA were incubated with RQ1 DNase (Promega) in presence of RNaseOUT (Invitrogen) during 25 min at 37 °C and extracted with phenol-chloroform then chloroform and finally precipitated with ethanol 100% and washed with ethanol 70%. RNA pellets were dissolved in water and quantitated by measuring optical absorption. Intravirion RNA were reverse transcribed using an oligo(dT) primer with the Expand RT (Roche). A control experiment was systematically performed without RT to control the absence of DNA contamination as previously described66 (link). To monitor viral RNA and MS cDNA, quantitative PCR assay was achieved with 125 ng of tRNA-equivalent virions or 125 ng of cellular DNA samples extracted from cells transfected with either wt or mutant pNL4-3 plasmids, or with empty plasmid as controls (mock). The qPCR was achieved with the SYBR Green kit (Roche) using a RotorGene (Labgene) system. A standard curve was generated from 102 to 106 copies of pNL4-3 plasmid. Nucleic acid level in virions and producer cells was normalized with respect to CAp24 protein (determined by ELISA) and GAPDH gene, respectively25 (link)26 (link). Sequences of primers and detailed PCR conditions were the same as previously used25 (link)26 (link) and will be provided on request.
6
Lck and GAPDH cDNA Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from fresh hamster tissues (testis, liver, brain and spleen) using the TRI reagent according to the manufacturer's instructions (Sigma). cDNA synthesis (Reverse transcription, RT) was performed with 5 µg of total RNA, Lck reverse primer (5′ TCAAGGCTGGGGCTGGTACTGGCCC 3′) or anti-GAPDH reverse primer (5′ TGATGGCATGGACTGTGGTCATGA 3′) and Expand RT (Roche) at 42°C for 1 h. PCR conditions after RT were as follows: initial denaturation step of 20 s at 95°C followed by 30 cycles of 45 s at 95°C, 1 min at 53°C and 1 min at 72°C. The sequencing analysis of the amplified product (both partial 278, 505, 602 and 972 bp) was performed on an ABI PRISM 3100 (Applied Biosystems) automated sequencing analyzer. Details of the primers are given in Supplementary Table 1 (see section on supplementary data given at the end of this article). The nested primers strategy used for amplification of full-length Lck cDNA are shown in Supplementary Fig. 2A.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!