Cfx96 real time system 3

FastPure^® Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, China) was used to extracted RNA. Hairpin-itTM microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit (GenePharma, China) was used for miRNA. For RNA, HiScript^®III All-in-one RT SuperMix Perfect for qPCR (Vazyme Biotech, China) was used for reverse transcription and Taq Pro Universal SYBR qPCR Master Mix (Vazyme Biotech, China) was used for qPCR. Results were obtained using the CFX96TM Real-time System 3.1 software (Applied Bio-Rad). A minimum of 3 replicate wells were set up for each sample and further analyzed using the 2^−ΔΔct method with U6 as the internal reference gene. All primers used in qPCR were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The primer sequences were as follows: miR-588, forward GATGCTCTTTGGCCACAATG, and reverse TATGGTTGTTCTGCTCTCTGTCTC; U6, forward CGCTTCGGCAGCACATATAC, and reverse TTCACGAATTTGCGTGTCATC; CCL5, forward ATTTGCCTGTTTCTGCTTGCTCTTG, and reverse AACTGCTGCTGTGTGGTAGAATCTG; TGF-β, forward AAGGTGAGGAAACAAGCCCAGAG, and reverse AAGTGCTAGGATTACAGGCGTGAG; GAPDH, forward AGATCCCTCCAAAATCAAGTGG, and reverse GGCAGAGATGATGACCCTTTT.

Total RNA was extracted from cells and tissues by using Trizol (Invitrogen) and was reversely transcribed into cDNA with random primers or miRNA with miRNA specific primers purchased from RiboBio by using the PrimeScript RT reagent Kit (TakaRa). The qPCR was performed by using gene primers or miRNA-specific qPCR primers purchased from RiboBio by using SYBR Select Master Mix (Life technologies). The PCR procedure was: 95°C for 3 minutes first, then 39 cycles at 95°C for 20 s, 60°C for 30 s, and 72°C for 30 s. The results were obtained with CFX96TM Real-time System 3.1 software (Applied Bio-Rad) and further analyzed with the 2^−ΔΔct method. The expression level of an mRNA or miRNA was calculated relative to the level of control U6 or GAPDH, respectively. All primers are listed in Table S1.