Multiscribe

RNA was extracted by mechanical suspension and lysis of muscle in TRIzol™ reagent (Thermo Fisher Scientific, Loughborough, UK). Phase separation and RNA precipitation was performed with the addition of chloroform and 2-propanol. RNA precipitates were reconstituted in RNase-free water and stored at −80 °C. cDNA was generated by reverse transcription in accordance with the manufacturer’s protocol (Multiscribe™, Thermo Fisher Scientific, Loughborough, UK). Expression of specific genes was assessed by real-time PCR using TaqMan^® Gene Expression Assays (Thermo Fisher Scientific, Loughborough, UK) on an ABI7500 system (Applied Biosystems, Warrington, UK). Final reactions contained 2X TaqMan PCR Mastermix (Thermo Fisher Scientific, Loughborough, UK), 200 nmol TaqMan probe and 25–50 ng cDNA. The abundance of specific mRNAs in a sample was normalized to the housekeeper gene GAPDH by calculating ΔCt values (Ct target − Ct GAPDH). For graphical illustrations, standardized expression values were transformed with the formula (2^−ΔCt) × 1000. For describing changes between experimental and control groups, the difference of ΔCt values as calculated as ΔΔCt = ΔCt[experimental group] − ΔCt[control group] and reported as fold change = 2^ΔΔCt.

Total RNA was isolated from the mouse brain tissues and primary microglia using an RNeasy kit (Qiagen) and transcribed into cDNA using MultiScribe reverse transcriptase (Thermo Fisher Scientific). Expression levels of TNF, IL-6, IL-1β, CCL2 and CCL3-encoding mRNAs were determined by quantitative real-time PCR (iTaq Universal SYBR Green System, Bio-Rad) and normalized to the level of GAPDH. The following primers were used: mouse TNF-forward, 5′-GTCCCCAAAGGGATGAGAAGTT-3′; mouse TNF-reverse, 5′-CTCCTCCACTTGGTGGTTTG-3′; mouse IL-6-forward, 5′-TCCGGAGAGGAGACTTCACA-3′; mouse IL-6-reverse, 5′-TGCCATTGCACAACTCTTTTC-3′; mouse IL-1β-forward, 5′-TGCCACCTTTTGACAGTGATG-3′; mouse IL-1β-reverse, 5′-TGATGTGCTGCTGCGAGATT-3′; mouse CCL2-forward, 5′-CACTCACCTGCTGCTACTCA-3′; mouse CCL2-reverse, 5′-GCTTGGTGACAAAAACTACAGC-3′; mouse CCL3-forward, 5′-TCCCAGCCAGGTGTCATTTTC-3′; mouse CCL3-reverse, 5′-TCAGGCATTCAGTTCCAGGTC-3′; mouse GAPDH-forward, 5′-GAAGGTCGCTGTGAACGGA-3′; mouse GAPDH-reverse, 5′-GTTAGTGGGGTCTCGCTCCT-3′.

RNA was isolated from the superficial (white) portion of the gastrocnemius muscle by Trizol–chloroform extraction of samples homogenized using a TissueLyser II (Qiagen, Hilden, Germany). RNA concentration and purity were assessed using a Nanodrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and 1 μg of total RNA was reverse transcribed using MultiScribe (Thermo Fisher Scientific). Expression of MAFbx/atrogin1 (Fbxo32: F: AACCGGGAGGCCAGCTAAAGAACA, R: TGGGCCTACAGAACAGACAGTGC), MuRF1 (Trim63: F: GAGAACCTGGAGAAGCAGCT, R: CCGCGGTTGGTCCAGTAG), myostatin (Mstn: F: CAGACCCGTCAAGACTCCTACA, R: CAGTGCCTGGGCTCATGTCAAG) and glyceraldehyde 3‐phosphate dehydrogenase (Gapdh: F: TGTGATGGGTGTGAACCACGAGAA, R: GAGCCCTTCCACAATGCCAAAGTT) was assessed in duplicate by quantitative real time PCR using Fast SYBR Green and a QuantStudio3 (Thermo Fisher Scientific) with the manufacturer's settings for Fast SYBR. Relative expression of Fbxo32, Trim63 and Mstn was calculated by the ΔΔC_t method with normalization to Gapdh.

The RNeasy kit (QIAGEN, Hilden, Germany) was used for isolation of total RNA from cell culture. Total RNA (1ug) was converted to cDNA using MultiScribe reverse transcriptase (Thermo Scientific, Rockford, IL, USA), and real-time PCR was performed using Power SYBR Green PCR Master Mix with specific primer to determine gene expression level. The primers are listed in supplementary Table 2. The ^ΔΔCt method was used for determining relative gene expression and beta-actin was used as a housekeeping gene.

Gene expression in cells and tissues was assessed using TaqMan® Gene Expression Assays (ThermoFisher Scientific). Tissues were homogenised in liquid nitrogen with a sterile pestle and mortar. mRNA was isolated using an innuPREP RNA Mini Kit (Analytikjena, Cambridge) as per the manufacturer’s instructions. One microgramme of RNA per sample was reverse transcribed using Multiscribe™ using the manufacturer’s protocol (ThermoFisher Scientific) to generate cDNA. Alp, Bglap, Redd1, Foxo1, Trim63 and Fbxo32 were determined using species-specific probe sets by real-time PCR on an ABI7500 system (Applied Biosystems, Warrington, UK). Final reactions are listed in Additional file 1: Table S2. mRNA abundance was normalised to that of 18S or GAPDH. Data were obtained as Ct values and ΔCt determined (Ct target – Ct 18S/GAPDH). Data were expressed as arbitrary units (AU) using the following transformation: [arbitrary units (AU) = 1000 × (2^−Δct)].