The largest database of trusted experimental protocols

Sigenome non targeting sirna 1

Manufactured by Horizon Discovery
Sourced in United Kingdom, United States

The SiGENOME Non-Targeting siRNA #1 is a reagent designed for use as a control in RNA interference (RNAi) experiments. It is a double-stranded RNA molecule that does not target any known gene in the human, mouse, or rat genome.

Automatically generated - may contain errors

13 protocols using sigenome non targeting sirna 1

1

siRNA Transfection of HUVECs

Check if the same lab product or an alternative is used in the 5 most similar protocols
GeneFECTOR (3:50) (VennNova, Parkland Fl) and siRNA (40 nM final) were diluted in Opti-MEM I (Invitrogen, Paisley, UK) and equal volumes of each were mixed and incubated at r/t for 5 min. siRNA complexes were added drop wise to HUVECs cultured in Opti-MEM I medium. After incubation for 4 h, culture medium was replaced with EGM2 medium (Lonza, Wokingham, UK) overnight and subsequently by M199/10% FCS. The following validated siRNA oligonucleotides were employed24 (link),54 (link),61 (link).
HO-1 (siHO-1 seq. 2) 5′- AACAUUGCCAGUGCCACCAAG-3′ (Qiagen, Manchester, UK).
AMPKα1 siRNA (Hs_PRKAA1_5) 5′-CCCACGATATTCTGTACA CAA-3′ (Qiagen).
CREB-1 pooled sequences (Dharmacon, Epsom, UK):
5′-GAGAGAGGTCCGTCTAATG-3′; 5′-CGTACAAACATACCAGATT-3′;
5′-GAGTGGAGATGCAGCTGTA-3′; 5′-TGACTTATCTTCTGATGCA-3′.
Nrf2 pooled sequences (Dharmacon):
5′-TGACAGAAGTTGACAATTA-3′; 5′-TAAAGTGGCTGCTCAGAAT-3′
5′-CCAAAGAGCAGTTCAATGA-3′; 5′-GAGAAAGAATTGCCTGTAA-3′.
The si-GENOME Non-Targeting siRNA #1 from Dharmacon containing 4 mismatches to any human, mouse or rat gene was used as a negative control.
+ Open protocol
+ Expand
2

Synchronize Cancer Cell Cycle for Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Prior to transfection, cells were starved for 6 h in order to achieve proper cell cycle synchronization. T98G cancer cells were transfected overnight with Dharmacon's chemically synthesized siRNA SMARTpools [human PC‐1, L‐007666‐00‐0005, ON‐TARGETplus Human PKD1 (5310) siRNA–SMARTpool, 5 nmol] and non‐targeting siRNA for control cells (D‐001210‐01‐05, siGENOME Non‐Targeting siRNA #1, 5 nmol), in dilution 1:20 in 1× siRNA buffer, using DharmaFECT 2 Transfection Reagent, 0.2 ml (Dharmacon) in dilution 1:50 in DMEM (Gibco, Thermo Fisher Scientific).18 (link), 19 (link) After 16 h, the medium was changed and the cells were treated with IgPC1 and/or HP and cultured for 24 and 48 h.
+ Open protocol
+ Expand
3

ATG5 Knockdown in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were transfected with siRNA targeting human ATG5 (siGENOME Human ATG5 siRNA-SMARTpool, M-004374-04; Dharmacon) or control siRNA (siGENOME Non-Targeting siRNA #1, D-001210-01; Dharmacon) at a final concentration of 10 nM using Lipofectamine RNAi MAX (Invitrogen).
+ Open protocol
+ Expand
4

siRNA Knockdown of PARP1 and AIF

Check if the same lab product or an alternative is used in the 5 most similar protocols
Knockdown experiments with siRNA were carried out by reverse transfection using Lipofectamine RNAiMAX (Thermo Fisher Scientific, Cat#13778150) and Opti-MEM (Thermo Fisher Scientific, Cat#31985) according to the manufacturer’s protocol. The final concentrations of PARP1 and AIF siRNA were 0.2 nM and 0.25 nM, respectively. The PARP1 siRNAs were purchased from Dharmacon (siGENOME Human PARP1 (142) siRNA #1 (D-006656-03-0010), target sequence: GCAACAAACUGGAACAGAU and siGENOME Human PARP1 (142) siRNA #2 (D-006656-04-0010), target sequence: GAAGUCAUCGAUAUCUUUA), and the AIF siRNAs were purchased from Thermo Fisher Scientific (Stealth siRNA Human AIF #1, target sequence: GGGUUAAGGUGAUGCCCAAUGCUAU and Stealth siRNA Human AIF #2, target sequence: GGAGUCAGCAGUGGCAAGUUACUUA). siGENOME Nontargeting siRNA #1 (Dharmacon) and Stealth siRNA Negative Control Medium GC Duplex #1 (Thermo Fisher Scientific) were used as controls. Each experiment was performed 2 days after transfection.
+ Open protocol
+ Expand
5

Knockdown of MCL-1, Bak, and Bax

Check if the same lab product or an alternative is used in the 5 most similar protocols
Certified siRNAs against MCL-1(SignalSilence Mcl-1 siRNA I, #6315), Bak (SignalSilence Bak siRNA I, #6486), and Bax (SignalSilence Bax siRNA I, #6321) were purchased from Cell Signaling. All Signal­Silence siRNA products from Cell Signaling Technology were tested by the manufacturer and shown by the company’s Western blot analysis to efficiently knock down the target proteins. Annealed siRNA against FBW7 (same sequence as in Wertz et al. [2011] and Wei et al. [2005] ), and control siRNA (siGENOME Non-targeting siRNA#1) were obtained from GE Dharmacon. All siRNAs were diluted to 20 μM with nuclease-free water as a stock solution. Two microliters of stock solution was mixed with 5 μl of Lipofectamine (Invitrogen) and then introduced onto the cells for 2 h; the cells were then washed with culture medium and cultured for 48 h (Uetake and Sluder, 2010 (link)).
+ Open protocol
+ Expand
6

LRP-1 Silencing in Thyroid Carcinoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The FTC133 human follicular thyroid carcinoma cell line was grown in Dulbecco’s Modified Eagle Medium-Ham’s F12 (Invitrogen, Cergy Pontoise, France) with 10% FBS, as previously described (44 (link)). SiRNA mediated silencing of LRP-1 was described elsewhere (9 (link)). Specific LRP-1 targeting sequences were designed by Dharmacon (distributed by Perbio Science, Brebiere, France) as follows: GACUUGCAGCCCCAAGCAGUU (sense), CUGCUUGGGGUGCAAGUCUU (antisense). Control transfection experiments were achieved by using SiGENOME Non-targeting siRNA #1 (D00121001-20) from Dharmacon. For transient transfection assays, siRNA were transfected for four hours by using Lipofectamine 2000 (Invitrogen) according to manufacturer instructions.
+ Open protocol
+ Expand
7

Transfecting AR siRNA in Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
SMARTpool siGENOME AR siRNA (Dharmacon), and the corresponding negative control, siGENOME Non-Targeting siRNA #1 (Dharmacon), were transfected into BC cell lines at a final concentration of 50 nM, through TransIT-X2® Dynamic Delivery System (Mirus Bio LLC, United States), in accordance with the instructions provided by the manufacturer. Opti-Mem Medium (Gibco, Thermo Fisher Scientific, United States) was used for transfection complex. Transfections were stopped and pellets collected at 48 h. AR transfection efficiencies and miR-9-5p expression were evaluated by qRT-PCR.
+ Open protocol
+ Expand
8

Modulating Wnt/β-Catenin Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
For siRNA transfections, cells were transfected 1 day after seeding with siGENOME APC siRNA #1-#3 (Dharmacon, catalog no. D-003869–05/06/07), Hs_CTNNB1_5 FlexiTube siRNA (Qiagen, catalog no. SI02662478), or siGENOME Non-Targeting siRNA #1 (Dharmacon, catalog no. D-001210–01-05) using INTERFERin (Polyplus-Transfection, catalog no. 409–10) using 72 ng siRNA/T-25 flask. Colo320 cells were transfected twice on 2 consecutive days. For plasmid transfections, cells were transfected 1 day after seeding with 4 μg myc-tagged β-catenin constructs (17 (link))/10-cm dish using Fugene 6 Transfection Reagent (Promega, catalog no.2691).
+ Open protocol
+ Expand
9

ADORA2B and TAp73 siRNA Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
ADORA2B knockdown was performed using pre-designed siGENOME SMARTpool Human ADORA2B siRNA purchased from Dharmacon (Lafayette, CO, USA). TAp73 isoform-specific knockdown was performed using Silencer Pre-designed TAp73 siRNA (ID: 115665) purchased from Ambion (Life Technologies). siGENOME Non-Targeting siRNA #1 (Dharmacon) and Silencer Negative Control siRNA #1 (Ambion, Life Technologies) were used as control siRNAs, respectively. ADORA2B siRNA oligonucleotides were transfected using Oligofectamine (Invitrogen, Life Technologies) at ~50% confluency according to the manufacturer's instructions for 72 h before treatment. TAp73 siRNA oligonucleotides were transfected using Lipofectamine RNAiMAX (Invitrogen) at ~30% confluency according to the manufacturer's instructions for 72 h before treatment.
+ Open protocol
+ Expand
10

siRNA-mediated knockdown of SMC2, hCAP-G, and hCAP-G2

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transfections were carried out by incubating 100 nM siRNA with transfection reagent Dharmafect I (Dharmacon) in DMEM. After 6 hours media were exchanged to fresh DMEM. Control experiments used non-targeting control RNA (Dharmacon, siGENOME Non-Targeting siRNA #1, 5’-UGGUUUACAUGUCGACUAA UU-3’), or water, as indicated. Targeting RNAs used were: SMC2/Cap-E sequence: #1: 5’-UGCUAUCACUGGCUUAAAUTT-3’, sequence #2: 5’-CAUAUUGGACUCCAUCUGCTT-3’; hCAP-G: sequence #1: 5’-UCAGAUAUGGAAGAUGAUGTT-3’, sequence #2: 5’-GUC UCAUGAAGCAAACAGCTT-3’; hCAP-G2: sequence #1: 5’-UGAUUG CAUCCAGGACUUCTT-3’, sequence #2: 5’-UAGCAAAGCUGACACGUTT-3’.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!