Revertaid first standard cdna synthesis kit

mRNA was extracted 1, 3, 9, and 24 hours after mEHT treatment of cultured tumor cells using RNeasy Mini Kit (#74104, Qiagen, Venlo, Netherlands). Complementary DNA synthesis was done with RevertAid First Standard cDNA Synthesis Kit (#K1622, Thermo Scientific, Waltham MA, USA). QPCR testing of RPLP0 (housekeeping gene), PUMA, BAX, BAK1, XIAP, BCL‐2, BCL‐XL, and P21 gene expression (Table 1; all primer pairs were purchased from Sigma‐Aldrich, St Luis, USA was performed with CFX Connect Real‐Time PCR Detection System (Bio Rad, California, USA) using the SsoAdvanced Universal SYBR Green Supermix (#1725271, Thermo Scientific)) according to the vendors instructions. The fold‐change of the genes of interest relative to RpLp0 was defined as 2^−ΔΔCT values.

Total RNA was extracted 24 h after treatment of tumor cells using the NucleoSpin RNA Plus XS (Macherey-Nagel GmbH & Co. KG; Düren, Germany). Complementary DNA (cDNA) synthesis was done with RevertAid First Standard cDNA Synthesis Kit (Thermo Scientific). The primer sets used were as follows: RPS13 Fwd: CGAAAGCATCTTGAGAGGAACA, Rev: TCGAGCCAAACGGTGAATC, CXCL-9 Fwd: AGTGCAAGGAACCCCAGTAG, Rev: AGGGCTTGGGGCAAATTGTT, CXCL-10 Fwd: AGCAGAGGAACCTCCAGTCT, Rev: AGGTACTCCTTGAATGCCACT, CXCL-11 Fwd: GAGTGTGAAGGGCATGGCTA and Rev: ACATGGGGAAGCCTTGAACA (Merck KGaA; Darmstadt, Germany). Quantitative real-time PCR was performed with CFX Connect Real‐Time PCR Detection System (Bio-Rad; California, USA) using the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). RPS13 was used as internal control, and the fold change in expression was calculated as 2^−ΔΔCT.

RNA was isolated from cell using the RNeasy Mini kit (Qiagen, Valencia, CA, USA). RNA concentration and quality were assessed with Nanodrop (Thermo Fischer Scientific). Up to 1 µg of total RNA was converted to cDNA using RevertAid First Standard cDNA synthesis kit (Thermo Scientific). Assessment of mRNA expression was performed by quantitative real-time PCR using cDNA corresponding to 20 ng RNA. PCR reactions were carried out in triplicate, with 300 nM each primer in a final volume of 20 μL of 2× SsoAdvanced™ Universal SYBR Green Supermix (BioRad, Hercules, CA, USA). All primers listed in Table 1 were purchased from Sigma-Aldrich (St Louis, MO, USA). Amplification was performed after one initial denaturation step of 10 min at 95 °C for 40 cycles at 94 °C/10 s and 60 °C/60 s with a CFX Connect™ Real-Time PCR Detection System (BioRad). The fold change of gene expression relative to RPLP0 was defined as 2^−ΔΔCT.