Pdr274 vector

For oligo cloning of sgRNA target sequences the previously published pDR274 vector was used^{27 (link)} (Addgene Plasmid #42250; sequences of primers used in this study are given in Table S1). For cas9 RNA synthesis the MLM3613^{27 (link)} (Addgene Plasmid #42251) or the pCS2-nCas9n vector^{28 (link)} (Addgene Plasmid #47929) were utilized. Both vectors were purchased from Addgene (www.addgene.org; Cambridge, USA). For designing and constructing of sgRNAs the open access ZiFit Targeter software (http://zifit.partners.org/ZiFiT/) was used. Specific target sites were identified by alignments of zebrafish and human sequences. sgRNA target site (GGATTCCAGGCCAGTTATGA) is located in exon 13 of fndc3a (ENSEMBL Zv9 Transcript: ENSDART00000097261) and targets the second Fibronectin type III domain, while sgRNA target site in exon 18 (GGCGTACAGTGGTTCGGCTC) targets the third Fibronectin type III domain.

pCS2-mCherry was kindly provided by Dr. N. Kinoshita (NIBB). The hCas9 plasmid (pX330) was purchased from Addgene (Cambridge, MA). The hCas9 gene was excised from pX330, then placed downstream of the SP6 promoter in the pSP64 vector (Promega) (pSP64-hCas9) and used for RNA synthesis. pCS2-mCherry and pSP64-hCas9 were linearized by digestion with NotI and SalI, respectively, and used as templates for mCherry and hCas9 mRNA synthesis using an in vitro RNA transcription kit (mMESSAGE mMACHINE SP6 Transcription Kit, Ambion, Austin, TX), according to the manufacturer’s instructions.
A pair of oligos targeting Fgf10 or mCherry was annealed and inserted into the BsaI site of the pDR274 vector (Addgene). The sequences of the oligos were as follows: Fgf10 (5’-GGAGAGGACAAAAAACAAGA-3’) and mCherry (5’- GGCCACGAGTTCGAGATCGAGGG -3’). After digestion with DraI, gRNAs were synthesized using the MEGAshortscript T7 Transcription Kit (Ambion, Austin, TX). The synthesized mRNAs and gRNAs were purified by phenol-chloroform-isoamylalcohol extraction and isopropanol precipitation. The precipitated RNA was dissolved in Opti-MEM I (Life Technologies) at 2–4 μg/μl, and stored at –20 °C until use. RNAs were quantified by absorption spectroscopy and agarose gel electrophoresis. The ssODNs were purchased from Sigma in dry form, dissolved in Opti-MEM I to 1 μg/μl, and stored at –20 °C until use.

Three single-guide (sg) RNAs targeting the function AT-hook domain of HMGA2 were designed. The pDR274 vector (Addgene, 42250) was used to conduct the sgRNA expression plasmids: pDR274-sgHMGA2-1, pDR274-sgHMGA2-2, and pDR274-sgHMGA2-3. Briefly, three annealed oligonucleotides were inserted downstream the T7 promoter in the Bsal digested pDR274, respectively, and those conducted plasmids were transformed in E. coli DH5α followed by DNA which were extracted with a plasmid extraction kit (QIAGEN, 12143). After the digestion by endonuclease DraI (Thermo Fisher, 0224), the digested products (290 bp) were purified using the QIAquick PCR Purification Kit and were then subjected to in vitro transcription with MEGAscript™ T7 Transcription Kit (Thermo Fisher, K0441). The transcribed sgRNAs were extracted using TRIzol™ Reagent (Invitrogen, 15596018) and quantified by Nano2000 spectrophotometry (Thermo Fisher Scientific Inc., USA) and nucleic acid electrophoresis. The primer sequences used for sgRNA synthesis are listed in Table 1.

The sgRNA for amhr2bY was designed using CCTOP [111 (link)]. Forward 5’-TAGGAGTAAGGCTCGGACCAGT-3’ and reverse 5’-AAACACTGGTCCGAGCCTTACT-3’ oligo nucleotide for target sequences of amhr2bY were annealed and cloned into the BsaI site of the pDR274 vector (Addgene, Watertown, MA. catalog number: #42250). The sgRNA was transcribed using DraI-digested gRNA expression vectors as templates using the ScriptMAX Thermo T7 Transcription kit (TOYOBO). Then, sgRNA was treated DNase I and purified by RNeasy Mini Kit (Qiagen). The 150 ng of Cas9 Nuclease protein NLS (Nippon Gene, Tokyo, Japan) and 25 ng of sgRNA were microinjected into fertilized ayu one-cell eggs obtained from the cultured strain derived from the Ota River population using a microinjector BJ-110 (BEX, Tokyo, Japan). The Body of amhr2bY-targeted G0 ayu were fixed in Bouin’s solution and analyzed histology of developing gonads. The head and tail of amhr2bY-targeted G0 ayu were used to extract genomic DNA. Mutations of target site for CRISPR/Cas9 were identified by genomic PCR using the primer set amhr2bY-11F and amhr2bY-12R for amhr2bY and amhr2a-11F and amhr2a-12R for amhr2a (S12 Table). The PCR products were cloned into a pGEM-T easy vector (Promega) and analyzed by Sanger sequencing to identify individual editing patterns. At least 8 clones per individual were examined.