(Fig. 6a , 6b , Supplementary Table 3 and Supplementary Fig. 21 ). MEF cells were cultivated until confluent, then pooled. Replicates were performed on the same day using three separate nucleofections followed by cultivation in separate wells. Each nucleofection contained 400 ng base editor plasmid and 100 ng guide RNA plasmid. Transfection programs were optimized following manufacturer’s instructions (CZ-167, P4 Primary Cell 4D-Nucleofector® X Kit, Lonza). Cells were harvested for genomic DNA extraction after ~96 h. ApoE4-expressing astrocytes were diluted to 200,000 astrocytes per 20-μL reaction and nucleofected with 750 ng base editor plasmid and 250 ng guide RNA plasmid (program EN-150, SF Cell Line 4D Nucleofector® X Kit, Lonza). Reactions were diluted to 100 μL with pre-warmed media, and half of the resulting solution was plated in 12-well dishes. After 72h, genomic DNA was extracted with 300 μL lysis buffer.
P4 primary cell 4d nucleofector x kit
Manufactured by Lonza
The P4 Primary Cell 4D-Nucleofector® X Kit is a laboratory equipment product designed for the transfection of primary cells. It provides a solution for efficient nucleic acid delivery into a variety of primary cell types.
Automatically generated - may contain errors
3 protocols using p4 primary cell 4d nucleofector x kit
1
Optimized Nucleofection of Base Editors
2
Establishment of CAT1-Knockout MEF Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Deletion of the CAT1 (SLC7A1) gene in a population of MEF cells was performed using CRISPR/Cas9, generating CAT1-KO cells. Briefly, four different sgRNAs (g1-ATGGGCTGCAAAAACCTGCTCGG, g2-CCAGGACTTACCGATGATGTAGG, g3-CACAAACGTGAAATACGGTGAGG, g4-CATCATGAGCGTGAGAGCGGCGG) were prepared using the EnGen sgRNA Synthesis Kit (New England BioLabs). The individual sgRNAs were associated with EnGen Cas9 NLS protein (New England BioLabs), which were then transfected into MEF cells using the 4D-Nucleofector System (Lonza) in combination with the P4 Primary Cell 4D-Nucleofector X Kit. As a negative control, EnGen sgRNA Control Oligo (CATCCTCGGCACCGTCACCC) was associated with Cas9 NLS and transfected into MEF cells. Targeted cell lines transfected with one of the sgRNAs, or a combination of all four, were validated by RT-qPCR using specific primers (S8A Fig ) and by immunoblot using antibody that specifically recognizes CAT1 (Abcam ab37588).
3
Optimized Nucleofection of Base Editors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
(Fig. 6a , 6b , Supplementary Table 3 and Supplementary Fig. 21 ). MEF cells were cultivated until confluent, then pooled. Replicates were performed on the same day using three separate nucleofections followed by cultivation in separate wells. Each nucleofection contained 400 ng base editor plasmid and 100 ng guide RNA plasmid. Transfection programs were optimized following manufacturer’s instructions (CZ-167, P4 Primary Cell 4D-Nucleofector® X Kit, Lonza). Cells were harvested for genomic DNA extraction after ~96 h. ApoE4-expressing astrocytes were diluted to 200,000 astrocytes per 20-μL reaction and nucleofected with 750 ng base editor plasmid and 250 ng guide RNA plasmid (program EN-150, SF Cell Line 4D Nucleofector® X Kit, Lonza). Reactions were diluted to 100 μL with pre-warmed media, and half of the resulting solution was plated in 12-well dishes. After 72h, genomic DNA was extracted with 300 μL lysis buffer.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!