Actin stain 555 fluorescent phalloidin

Manufactured by Cytoskeleton

Actin-stain™ 555 Fluorescent Phalloidin is a fluorescent reagent used to label and visualize actin filaments (F-actin) in cells. It binds specifically to F-actin, allowing for the detection and analysis of the cytoskeleton using fluorescence microscopy.

Automatically generated - may contain errors

Lab products found in correlation

4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (2 mentions) Kn 93, by Selleck Chemicals (1 mentions) Cy3 streptavidin, by Jackson ImmunoResearch (1 mentions) Anti βiii tubulin tuj1 antibody, by Merck Group (1 mentions) Blebbistatin, by Selleck Chemicals (1 mentions) Cdcl2, by Merck Group (1 mentions)

Close spelling variants of this product

Actin-stain 555 phalloidin (13 citations) Actin-stain™ 555 (4 citations) Fluorescent phalloidin (3 citations)

2 protocols using actin stain 555 fluorescent phalloidin

Fixation and Cytoskeletal Staining

Check if the same lab product or an alternative is used in the 5 most similar protocols

After loading hypergravity, the cell monolayers were treated with 4% paraformaldehyde (PFA) to fix the cells. Then, staining of the nuclei (using DAPI; Thermo Fisher Scientific) and acting filaments (using Actin-stain^™ 555 Fluorescent Phalloidin; Cytoskeleton, Inc.) was carried out.

Kim J., Montagne K., Nemoto H., Ushida T, & Furukawa K.S. (2017). Hypergravity down-regulates c-fos gene expression via ROCK/Rho-GTP and the PI3K signaling pathway in murine ATDC5 chondroprogenitor cells. PLoS ONE, 12(9), e0185394.

+ Open protocol

+ Expand

Investigating CaMKII Regulation in Neurons

Check if the same lab product or an alternative is used in the 5 most similar protocols

KN93 and Blebbistatin were obtained from Selleck Chemicals. CdCl 2 was from Sigma-Aldrich. The anti-βIII tubulin (TUJ1) antibody was from Sigma-Aldrich. Primary antibody against β-actin and phospho-CaMKII were from Cell Signaling Technology. Alexa fluor ® plus 488 or 568 secondary antibodies were purchased from Life Technologies. Dextran biotin (BDA) was purchased from Life Technologies. Cy3-Streptavidin was from Jackson Laboratories.
Actin-stain 555 Fluorescent Phalloidin was from Cytoskeleton. The siRNA against CaMKIIγ was from GenePharma (Shanghai, China) which targeted the following sequences: AACGTGGTACATAATGCTACA, CACAGTCACTCCTGAAGCTAA and ATCATTAAGATCACAGAACAA.

Xi F., Xu R.J., Xu J.H., Ma J.J., Wang W.H., Wang F., Ma Y.X., Qi S.B., Zhang H.C., Zhang H.N., Qin X.Z., Chen J.Q., Li B., Liu C.M., Yang H.L., Meng B, & S.a.i.j.i.l.a.f.u. (2019). Calcium/calmodulin-dependent protein kinase II regulates mammalian axon growth by affecting F-actin length in growth cone. Journal of cellular physiology, 234(12).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!