Genomic DNA was isolated from EDTA-treated whole blood using the Gentra Puregene extraction kit (Qiagen Sciences, Germantown, MD), quantified, standardized to 50ng/ul, and quality checked with Picogreen (Invitrogen, Eugene, OR) and Nanodrop assays (Thermo Scientific, Wilmington, DE). Cytosine methylation was measured at site -934 upstream of the OXTR start codon by bisulfite pyrosequencing as reported in Jack et al. (35 (link)) in Dr. Connelly's laboratory at the University of Virginia. Samples were amplified in triplicate and randomized for pyrosequencing to account for plate and run variability, and averaged. On average, samples deviated from the mean ±1.4%.
Nanodrop assay
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Nanodrop Assay is a spectrophotometric measurement device used to determine the concentration and purity of nucleic acid and protein samples. It measures the absorbance of a sample at specific wavelengths to quantify the amount of analyte present.
Automatically generated - may contain errors
Lab products found in correlation
Gentra puregene extraction kit, by Qiagen (2 mentions)
Picogreen, by Thermo Fisher Scientific (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Taqman, by Thermo Fisher Scientific (1 mentions)
7900ht thermal cycler, by Thermo Fisher Scientific (1 mentions)
Taqman primer probe, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis supermix kit, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Applied biosystems 7500 real time pcr, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Primescripttm rt reagent kit, by Takara Bio (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Bca protein assay reagent, by Thermo Fisher Scientific (1 mentions)
Ultracentrifuge, by Beckman Coulter (1 mentions)
Scgp00525, by Merck Group (1 mentions)
6 protocols using nanodrop assay
1
OXTR Promoter DNA Methylation
2
COMT Genotyping in Human Genomic Studies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from ethylenediaminetetraacetic acid (EDTA)-treated whole blood using the Gentra Puregene extraction kit (Qiagen Sciences, Germantown, MD), quantified, and quality checked with Picogreen (Invitrogen, Eugene, OR) and Nanodrop assays (Thermo Scientific, Wilmington, DE). A sequence validated TaqMan (Applied Biosystems) assay was utilized for genotyping which was done blind to behavioral data. We compared G/G homozygotes (i.e., individuals homozygous for the Val allele) to A/A homozygotes and A/G heterozygotes (i.e., carriers of the Met allele). Examining genotype in an additive fashion indicated that A/A homozygotes and heterozygotes displayed nearly identical patterns of results for the PCET, and both groups differed from the G/G homozygotes. Therefore, we collapsed across A-carriers and A/A homozygotes to increase statistical power. We did not observe any deviations from Hardy-Weinberg equilibrium for the COMT rs4680 SNP in our study sample (p = .38).
3
Quantifying Bcl-x Expression Changes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from paired untreated and tamoxifen-treated Eμ-Myc lymphoma cells using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The RNA was treated with DNase to remove contaminating DNA using the RNase-free DNase Qiagen kit according to the manufacturer's instructions. RNA quality and quantity were determined using the NanoDrop assay (Thermo Fisher Scientific). Aliquots of 1 μg of RNA were reverse-transcribed into cDNA using the SuperScript III first strand synthesis Supermix kit (Invitrogen) in a 20-μL reaction volume according to the manufacturer's instructions. The cDNA was diluted 10-fold in H2O, and PCR amplifications of 1 μL of cDNA were performed with an Applied Biosystems 7900HT thermal cycler using TaqMan Universal PCR Mastermix and 0.5 μL of TaqMan primer/probes (both Applied Biosystems) in a 10-μL reaction volume. Assays specific for Bcl-x (Mm00437783) and (as an endogenous control for RNA quality/input) HMBS (Mm01143545) transcripts were performed. Three replicates of each reaction were performed. All qPCR data were analyzed using the 2−ΔΔCT method and expressed relative to the untreated sample of each pair.
4
Quantitative RT-PCR Analysis of Osteoblastic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of total RNA from MC3T3-E1 cells was done by RT-qPCR RNAiso Plus (TaKaRa Biotechnology, China), according to the manufacturers’ instructions. Total concentration and purity of RNA were detected using Nanodrop Assay (Thermofisher). Reverse transcription was carried out with Prime Script™ RT Master Mix, to synthesize the first strand cDNA. qPCR was also done with SYBR Premix Ex Taq II (TaKaRa Biotechnology, China). The assay primer sequence was as follows:
RUNX2, F: 5ʹ- CCCAGTATGAGAGTAGGTGTCC −3ʹ, R: 5ʹ- GGGTAAGACTGGTCATAGGACC −3ʹ;
ALP, F: 5ʹ-ACACCTTGACTGTGGTTACTG-3, R: 5ʹ-CCATATAGGATGGCCGTGAAG-3ʹ;
OCN, F: 5ʹ-ACACCATGAGGACCATCTTTC-3, R: 5ʹ-CGGAGTCTGTTCACTACCTTATT-3;
PDCD4, F 5ʹ-TCG TCGTTACGATTGGTTAGTC-3, R5ʹ-GAAAAATCTCTA ACCCTTCTCGC-3ʹ;
β-actin, F:5ʹ-AATGTGGCTGAGGACTTTG-3, R: 5ʹ-GGGACTTCCTGTAACCACTTATT-3ʹ.
U6: 5ʹ-CTCGCTTCGGCAGCACA-3ʹ; R, 5ʹ-TGGTGTCGTGGAGTCG-3ʹ.
The system was then run through Applied Biosystems 7500 Real-Time PCR (Applied Biosystems, Canada). The amplification of qPCR was done as follows: initial denaturation at 95°C for 10 min, followed by 40 cycles at 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min. The relative gene expression levels were assessed using 2−∆∆Ct method.
RUNX2, F: 5ʹ- CCCAGTATGAGAGTAGGTGTCC −3ʹ, R: 5ʹ- GGGTAAGACTGGTCATAGGACC −3ʹ;
ALP, F: 5ʹ-ACACCTTGACTGTGGTTACTG-3, R: 5ʹ-CCATATAGGATGGCCGTGAAG-3ʹ;
OCN, F: 5ʹ-ACACCATGAGGACCATCTTTC-3, R: 5ʹ-CGGAGTCTGTTCACTACCTTATT-3;
PDCD4, F 5ʹ-TCG TCGTTACGATTGGTTAGTC-3, R5ʹ-GAAAAATCTCTA ACCCTTCTCGC-3ʹ;
β-actin, F:5ʹ-AATGTGGCTGAGGACTTTG-3, R: 5ʹ-GGGACTTCCTGTAACCACTTATT-3ʹ.
U6: 5ʹ-CTCGCTTCGGCAGCACA-3ʹ; R, 5ʹ-TGGTGTCGTGGAGTCG-3ʹ.
The system was then run through Applied Biosystems 7500 Real-Time PCR (Applied Biosystems, Canada). The amplification of qPCR was done as follows: initial denaturation at 95°C for 10 min, followed by 40 cycles at 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min. The relative gene expression levels were assessed using 2−∆∆Ct method.
5
Quantitative Analysis of Osteogenic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified using an RNeasy Mini kit (QIAGEN GmbH, Hilden, Germany). The RNA concentration and purity were measured by Nanodrop Assay (Thermo Fisher Scientific, Waltham, MA, USA). For cDNA synthesis, RNA was reverse transcribed using a PrimeScriptTM RT reagent Kit (Takara Bio Inc., Shiga, Japan). For quantitative RT-PCR analysis, gene-specific primers including Gapdh (glyceraldehyde-3-phosphate dehydrogenase), Col1a1 (collagen Type I α-1), Spp1 (osteopontin), Ocn (osteocalcin), and Cbfa1 (core-binding factor α-1), and TGF-β1 (transforming growth factor beta 1) were designed for use with TaqMan Gene Expression Assays (Applied Biosystems Japan Ltd., Tokyo, Japan; Gapdh: Mm99999915_g1, Col I: Mm00801666_g1, Spp1: Mm00436767_m1, Ocn: Mm03413826_mH, Cbfa1: Mm00501584_m1, and TGF-β1: Mm00498234_m1). The qPCR amplification was carried out as follows: initial heating at 95°C for 20 s, followed by 40 cycles of denaturation at 95°C for 1 s, and annealing at 60°C for 20 s. Gene copy numbers were measured in triplicate and normalized against the average copy number for Gapdh.
6
Isolation and Purification of Small Extracellular Vesicles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A classical differential UC protocol (31 (link)) was used with minor modifications to isolate sEVs. 5 × 106 HPSC/HPaStec cells were seeded in a T150 cm2 flasks (corning) at 50% confluence in each respective medium with 10% exosome-free FBS (Thermo Scientific, #A2720803), and the conditioned medium was harvested when cells were 70% to 80% confluent (48 h). Cell-conditioned media was cleared of cells, cell debris, and large membrane vesicles by sequential centrifugation at 500g for 30 min followed by 12,000g for an additional 30 min and was then filtered through a 0.22 μM filter unit (Millipore, #SCGP00525). This step was done to maximize quality over quantity to exclude the apoptotic bodies and other debris supported by previous publications (24 (link), 28 (link), 32 (link)).To sort by density, sEVs were collected from the cleared supernatants after centrifugation at 100,000g for 2 h in SWT32i (Beckman) swinging buckets using a Beckman Coulter ultracentrifuge (Beckman). The sEVs were washed with PBS and repurified by centrifugation at 100,000g for 2 h. The pellets were resuspended in 0.22 μM–filtered PBS. Exosomal protein quantity was estimated by Pierce bicinchoninic acid (BCA) protein assay reagent (Thermo Scientific, #23227) and Nanodrop assay (Thermo Scientific), according to the manufacturer’s instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!