Epitect plus ffpe bisulfite kit

Tumor-dense areas of 20 μm FFPE tissue sections were manually dissected and genomic DNA (gDNA) was isolated and bisulfite converted using the EpiTect® Plus FFPE Bisulfite Kit (Qiagen). Purified converted DNA was subjected to methylation-specific PCR (MSPCR) using the EpiTect® MSP Kit (Qiagen). The unmethylated template primers were (forward) TTGGTTTTTGTGGTAATGGAAAAGTGT and (reverse) CAAAAAATCTCAACAAACTCACACCA, resulting in an 86 base pair PCR product. The methylated template primers were (forward) TCGTGGTAACGGAAAAGCGC and (reverse) AAATCTCAACGAACTCACGCCG, resulting in a 75 base pair PCR product. These primers have been extensively characterized by previous groups (Figure 2A) [10 (link),23 (link)]. PCR conditions were as follows: 95.0°C for 10 minutes, then 35 cycles of 94.0°C for 15 seconds, 55.0°C for 30 seconds, 72.0°C for 30 seconds, and a final extension at 72.0°C for 10 minutes. PCR products were electrophoresed on a 2.5% agarose gel stained with ethidium bromide and visualized on a UVP Bioimaging system. Specificity of the reactions was confirmed using the EpiTect® Control DNA set (Qiagen) with the same primers and PCR conditions. The presence of a methylated band was recorded as “positive” for BRCA1 PM (Figures 2B-2C).

Urine samples were centrifuged to generate a pellet, and genomic DNA from the pellet was purified using a kit from IBI (Valley Park, MO), protocol: dx.doi.org/10.17504/protocols.io.3awgife. For frozen prostate tissues, ~2mg of tissue was homogenized and two-thirds of the sample was utilized for RNA isolation using Perfect Pure RNA Tissue Kit (5-Prime). DNA extraction was performed with a DNeasy Blood & Tissue Kit (Qiagen, MD). For the FFPE prostate biopsy samples, two 10-micron sections were obtained and DNA isolation and sodium bisulfite modification were performed using the EpiTect Plus FFPE Bisulfite Kit (Qiagen, MD), protocol: dx.doi.org/10.17504/protocols.io.3bfgijn. DNase was applied to total RNA to eliminate any contaminating genomic DNA.

Extraction of genomic DNA was conducted utilizing the QIAamp^® DNA Mini Kit (Qiagen, Hilden, Germany) from 25 mg of SF sample and QiAamp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany, Catalogue No. 56404) from eight freshly cut sections with a thickness of 10 µm from FFPE sample. The genomic DNA (2 µg) was modified by sodium bisulfite using EpiTect^® Bisulfite Kit (Qiagen, Hilden, Germany) for the SF DNA sample and Epitect Plus FFPE bisulfite kit (Qiagen, Hilden, Germany, Catalogue No. 59144) for FFPE DNA sample. BioSpec–nano UV–Vis Spectrophotometer (Shimadzu, Kyoto, Japan) was utilized for the determination of quantity and quality of isolated DNA and bisulfite-converted samples. The DNA samples were quality checked by agarose gel electrophoresis (2% agarose gel).