Isolates were screened for Shiga toxins using the primers previously described [7 (link)]. For all the STEC isolates, a recently developed simple PCR Shiga toxin subtyping method was used. Primers used included stx1 and stx2 detection and subtyping primers described in the paper [7 (link)] (Table 1 ). Two hundred (200 ng) of DNA, 0.5 μL of 10 uM primer, 12.5 μL of the Amplitaq Gold master mix (Applied Biosystems), and variable amounts of water were included in a total of 25 μL reaction volume. The thermocycling conditions followed the initial denaturation conditions recommended by the manufacture: 95 °C for 10 min followed by 35 cycles of 95 °C for 50 s, 56 °C for 40 s, and 72 °C for 60 s for detection and annealing temperature of 64 °C for subtyping. The amplified PCR products were visualized in 1.2% Ethidium bromide gels under UV light. ATCC strains 35150 and 25922 were used as positive and negative controls for stx gene detection, respectively.
Amplitaq gold master mix
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, Switzerland
AmpliTaq Gold Master Mix is a pre-formulated reagent designed for use in PCR (Polymerase Chain Reaction) amplification. It contains thermostable DNA polymerase, dNTPs, and necessary cofactors for efficient DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions)
Abi 3730 dna analyzer, by Thermo Fisher Scientific (2 mentions)
Sequencher 5, by Gene Codes (2 mentions)
Nextera xt library preparation kit and indices, by Illumina (2 mentions)
Clc genomics workbench v20, by Qiagen (2 mentions)
Miseq system, by Illumina (2 mentions)
Abi 3100 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator cycle sequencing kit v3, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Agencourt ampure xp, by Beckman Coulter (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Dna isolation kit for cells and tissue, by Roche (1 mentions)
Gel doc ez imager, by Bio-Rad (1 mentions)
T100 thermal cycler, by Bio-Rad (1 mentions)
Phusion plus pcr master mix, by Thermo Fisher Scientific (1 mentions)
Hemo klentaq, by New England Biolabs (1 mentions)
Gotaq green master mix, by Promega (1 mentions)
In fusion hd ecodry cloning kit, by Takara Bio (1 mentions)
Ez dna methylation gold kit, by Zymo Research (1 mentions)
24 protocols using amplitaq gold master mix
1
Shiga Toxin Detection and Subtyping
2
DNA Extraction and Sequencing Protocol for Ericaceous Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from leaf samples using the cetyltrimethylammonium bromide method (Murray & Thompson, 1980 ), after treatment with sorbitol extraction buffer (Wagner et al., 1987 ). Two cpDNA and eight nDNA regions were sequenced in order to detect DNA polymorphisms. Two cpDNA loci (trnG intron and rpl36‐rps8) were PCR‐amplified from four individuals per population using universal primers (Kress, Wurdack, Zimmer, Weigt, & Janzen, 2005 ; Shaw et al., 2005 ). For the eight nDNA loci, primers developed for other Ericaceous species (C16 and C22 [Wei, Fu, & Arora, 2005 ], EST39, EST65, EST121, and EST136 [De Keyser, De Riek, & Van Bockstaele, 2009 ], PHYB and PHYE [Ikeda & Setoguchi, 2010 ]) were used for PCR amplification of seven or eight individuals per population (Table S1). PCR was performed with an initial denaturation for 4 min at 94°C followed by 35 cycles of denaturation for 60 s at 94°C, annealing for 60 s at 55 or 60°C and extension for 60 s at 72°C, and a final extension for 7 min at 72°C, using AmpliTaq Gold Master Mix (Applied Biosystems). After PEG precipitation (Hartley & Bowen, 1996 ), the PCR products were sequenced directly using the standard method provided with the BigDye Terminator Cycle Sequencing kit v. 3.1 (Applied Biosystems) and separated by electrophoresis on an ABI 3100 Genetic Analyzer (Applied Biosystems).
3
RNA Isolation and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolation and purification of CC and kidney total RNA were performed with TRIzol reagent according to the manufacturer's instructions (Life Technologies, Carlsbad, CA, USA). RNA concentration and quality were determined spectrophotometrically and by electrophoresis in 1.2% non-denaturing agarose gels. Synthesis of cDNA was performed using M-MLV reverse transcriptase (200 U/μL; Promega, Madison, WI, USA). A negative control (a reaction that did not contain the RT enzyme) was carried out in parallel with each retro-transcription. Polymerase chain reaction (PCR) amplifications were carried out in 50 μL of final volume using 1 to 2 μL of cDNA as a template. The primers used for this experiment are listed in Table S1 . The gene HPRT, which encodes the enzyme hypoxanthine-guanosine phosphoribosyltransferase, was chosen as the endogenous standard for RT-PCR. Amplifications were performed using AmpliTaq Gold Master Mix (Applied Biosystems, Foster City, CA, USA). PCR products were separated by electrophoresis in 1% (w/v) agarose gels and visualized under ultraviolet light after ethidium bromide staining.
4
Identifying Stb16q Haplotypes in Wheat
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 156 hexaploid wheat accessions were used to identify Stb16q haplotypes. This collection was composed of 73 SHWs, 45 accessions originated from the wheat core-collection28 (link), 23 recent cultivars, 12 accessions from the wheat Stb differential16 (link), ND495 and two landraces (Supplementary Data 4 ). Stb16q CDS was entirely sequenced only for accessions carrying the same exon1 as TA4152-19. PCR products were generated using the AmpliTaq Gold® Master Mix (Applied Biosystems), purified using Agencourt AMPure XP (Beckman Coulter), and Sanger sequenced at GATC Biotech SARL (Konstanz, Germany). The MEGA software was used to align the different sequences and to identify haplotypes.
5
Genomic DNA Extraction and PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from the head and/or prothorax or legs, following the Qiagen DNeasy Blood & Tissue Kit (QIAGEN) tissue protocol. PCR follows [35 (link)] with the following modifications: the reaction was performed in a 20 μL reaction volume using, 0.5 μM of each primer, 10 μL AmpliTaq Gold, Master Mix (Applied Biosystems), and 3 μL of the respective genomic DNA extract. If target genes were difficult to amplify 0.4 μg Bovine Serum Albumin (BSA) were added. The general PCR profile consisted of an initial denaturation step at 94 °C for 2 min, followed by 30 cycles at 94 °C for 1 min, 52–68 °C for 30 s, and 72 °C for 1-2 min, and a final extension step of 10 min at 72 °C. The annealing temperature was optimized separately for each pair of primers. TP1, CAD, Wg were amplified using the nested PCR approach described by [36 (link)]. All primers used for amplification and amplification strategies are listed in Additional file 4 : Table S3. The PCR products were purified with ExoSAP-IT (Stratagene), and then sequenced. All fragments were sequenced in both directions. The GenBank accession numbers of the sequences are given in Additional file 1 : Table S1.
6
Multiplex Genotyping of HTTLPR and STin2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Assay for genotyping the HTTLPR and STin2 is generally based on the method described by Wendland et al. (2006) (link) with slight modifications. Multiplex polymerase chain reaction (PCR) protocol was used along with two different primer pairs (Supplementary Table S1 ) to amplify fragments including HTTLPR (S – 469bp and L – 512 bp) as well as STin2 VNTR genotypes (9, 10, and 12 repeats). The final reaction volume (20 ul) contained 1x AmpliTaq Gold MasterMix (Applied Biosystems, California, CA, United States) and oligonucleotide primers (TAG Copenhagen A/S) (Supplementary Table S1 ) at final concentration of 200 and 350 nM each, respectively. The final amount of gDNA was 25 ng. Thermal cycling consisted of 4 min of initial denaturation at 95°C followed by 41 cycles of 95°C (20 s), 62°C (20 s), and 72°C (20 s) each with a final extension step of 2 min at 72°C. Subsequently, 10 ul of PCR product was loaded onto a 2% agarose gel, run for 1 h and 10 min at 160V in TBE and visualized by ethidium bromide.
7
Screening IDH1 and IDH2 Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both IDH1 and IDH2 genes were analysed after using routine DNA Isolation kit for Cells and Tissue (Roche), specific amplifications (AmpliTaqGold Master Mix with the appropriate primers - IDH1 exon4 forward: aaaactttgcttctaatttttctcttt; reverse: acatacaagttggaaatttctgg,; IDH2 exon4 forward: tctagactctactgccttcctc; reverse: gtcagtggatcccctctcca – AppliedBiosystems), purification (ExoSAP-IT – Affimetrix) and direct sequencing (25 cycles at 51 °C, BigDye 3Terminator v3.1 Cycle Sequencing Kit in Genetic Analyser 3500 - Applied BioSystem).
8
RT-PCR Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR was carried out in 10 μl reactions with 20 ng cDNA and 10 μM of each primer (S1 Table ) amplified with AmpliTaqGold Master Mix (Applied Biosystems) by Touch down 65–55 0C PCR using the following cycling conditions: 96°C for 10 minutes; 20 cycles: 94°C for 15 seconds, 65°C (reduced by 0,5°C per cycle from 65°C to 55°C) for 30 seconds, and 72°C for 30 seconds; 25 cycles: 94°C for 15 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. PCR products were separated by electrophoresis on 2% agarose gel containing Gel Red, and photographed. RT-PCR products were sent to GATC Biotech for purification and Sanger sequencing using forward and reverse PCR primers, respectively (www.gatc-biotech.com ).
9
Comparative Evaluation of DNA Polymerase Reagents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four different DNA Polymerase reagents were tested as part of this study: GoTaq Green Master Mix (Promega, Madison, WI, USA), Phusion Plus PCR Master Mix (Thermo Scientific, Waltham, MA, USA), AmpliTaq Gold Master Mix (Applied Biosystems, Waltham, MA, USA), and Hemo KlenTaq (New England BioLabs, Ipswitch, MA, USA). The gene chosen for amplification was the 16s rRNA gene and the primers used have been published previously [26 (link)]. Following PCR, the amplified DNA was run on a 1% agarose gel, stained with ethidium bromide, and imaged using a Bio-Rad Gel Doc EZ Imager (Bio-Rad, Hercules, CA, USA). Gel images are shown in Supplementary File S2 . All reagents were used following protocols described by their respective manufacturers and run in a Bio-Rad T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA). DNA extracted through the phenol–chloroform method yielded higher concentrations than the other two extraction methods; therefore, 0.5 µL of DNA from each sample was used for PCR. The exact protocol details and thermocycler conditions for each reagent are as follows:
10
Cloning Truncated HMGB1 in pET22b Vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pET22b(pelB-)HMGB1-ΔC was constructed by cloning a truncated form of HMGB1 coding sequence in the pET22b(pelB-) expression vector. The DNA sequence corresponding to HMGB1 amino acid 1 to 185 was amplified by PCR using AmpliTaq gold master mix (Applied Biosystems) according to the manufacturer’s instructions and forward (5′TAAGAAGGAGATATACATATGGGCAAAGGAGATCCTAA3′) and reverse (5′GACGGAGCTCGAATTCGGCTTCTTTTTCTTGCTTTTTT3′) primers. The PCR product was then inserted in the pET22b(pelB-) expression vector at NdeI/EcoRI sites using an In-Fusion HD EcoDry cloning kit (Clontech). All constructs were validated through Sanger sequencing using the Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Waltham, MA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!