Real time taqman qpcr assays

qPCR analysis was performed by first isolating total RNA using Trizol/Chloroform and isopropanol precipitation from freshly isolated DRG neurons (Life Technologies). Generation of cDNA was achieved by Reverse Transcription using the QuantiTect Reverse Transcript Kit (Qiagen). For qPCR, FastStart Universal probe master mix (Rox) from Roche Diagnostics was used. The reaction was run in the Eco Real-Time PCR instrument (Illumina) using 0.5 ul of the cDNA in a 10 ul reaction according to the manufacturer's instructions. Real time Taqman qPCR assays were purchased from Integrated DNA Technologies with a FAM reporter dye and a non-fluorescent quencher: mouse Piezo2 (Mm.PT.56a.32860700, Fam38b), and an internally designed mouse Gapdh assay (forward primer- GCACCACCAACTGCTTAG; reverse primer- GGATGCAGGGATGATGTTC and probe- CAGAAGACTGTGGATGGCCCCTC).
Calibrations and normalizations were done using the 2^-ΔΔCT method, where ΔΔC_T = ((C_T (target gene) -C_T (reference gene)) - (C_T (calibrator) - C_T (reference gene)). Gapdh was used as the reference gene for all qPCR experiments^{33 (link)}.

qPCR analysis was performed as previously described (14 (link)). Briefly, total RNA was extracted using TRIzol/chloroform and isopropanol precipitation from freshly isolated dorsal root ganglion neurons (Life Technologies). Generation of complementary DNA was achieved by reverse transcription using the QuantiTect Reverse Transcript kit (Qiagen). For qPCR, FastStart Universal probe master mix (Rox) from Roche Diagnostics was used. The reaction was run in the Eco RealTime PCR instrument (Illumina) using 0.5 μl of the cDNA in a 10 μl reaction according to the manufacturer’s instructions. Real-time Taqman qPCR assays were purchased from Integrated DNA Technologies with a FAM reporter dye and a non-fluorescent quencher: mouse Piezo2 (Mm.PT.56a.32860700), and an internally designed mouse Gapdh assay (forward primer: GCACCACCAACTGCTTAG; reverse primer: GGATGCAGGGATGATGTTC; and probe: CAGAAGACTGTGGATGGCCCCTC).