To construct the MaAreB-disruption vectors, about 1000-bp up- and down-stream fragments of MaAreB were cloned from WT genomic DNA and inserted into pK2-SM-F and pK2-SM-R vectors [30 (link)] to form the gene knockout vectors, pK2-SM-MaAreB-F and pK2-SM-MaAreB-R (Figure S1A ). The DNA and promoter sequence of MaAreB was amplified and inserted into pK2-sur vector [31 (link)] to form the complementation plasmid, pK2-sur-MaAreB (Figure S1B ). Both knockout and complementation recombinant vectors were transferred into AGL1 for fungal transformation [32 (link)]. The ΔMaAreB and CP transformants were screened on CZA plates supplemented with 0.5 g/L glufosinate-ammonium (Sigma, St. Louis, MO, USA) or 0.02 g/L chlorimuron ethyl (Sigma, Bellefonte, PA, USA), respectively. Firstly, the fragments of target gene and resistance genes were amplified for preliminary verification of the transformants. On the other hand, Southern blotting was used for further verification via DIG High Prime DNA Labeling and Detection Starter Kit I (Roche, Basel, Switzerland) (Figure S1C ). All primers are listed in Table S1 .
Chlorimuron ethyl
Manufactured by Merck Group
Sourced in United States, China
Chlorimuron ethyl is a chemical compound used as an active ingredient in certain herbicide products. It functions as an inhibitor of the enzyme acetolactate synthase, which is essential for the production of branched-chain amino acids in plants. This disrupts the growth and development of susceptible plant species.
Automatically generated - may contain errors
12 protocols using chlorimuron ethyl
1
Construction of MaAreB Disruption Vectors
2
Complementation of ada-6 gene in Neurospora
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid pCB1532-ada6 used for complementation was created by inserting a 4547 bp DNA fragment, containing the ada-6 gene (2230 bp) flanked by a 1238 bp upstream regulatory region and a 1079 bp downstream region, into the plasmid pCB1532 which harbors a sulfonylurea resistant allele of the Magnaporthe griseaILV1 as a selective marker (Sweigard et al., 1997 (link)). Briefly, the DNA fragment was amplified from the wild-type strain FGSC#4200 using primers Ada6F-EcoRI: GGAATTC GTAAAGTGACTGGAAGGTGG and Ada6R-HindIII: CCCAAGCTT ATCAATAACATAACTGCCCCC (EcoRI and HindIII sites were underlined), digested by EcoRI and HindIII and ligated into plasmid pCB1532. The construct pCB1532-ada6 was transformed into the Δada-6 mutant FGSC#11022 according to the previously reported protoplast transformation method (Royer and Yamashiro, 1992 (link)). 15 μg/ml of chlorimuron ethyl (Sigma) was added to the top agar to inhibit the growth of non-transformed protoplasts. Obtained transformants were subjected to serial transfers on slants with 15 μg/ml chlorimuron ethyl to favor homokaryon formation (Ebbole and Sachs, 1990 (link)) and further verified by PCR.
3
Knockout and Complementation Strains Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used pK2-PB with phosphinothricin resistance gene and pK2-sur chlorimuron ethyl resistance gene to construct knockout and complementation strains, respectively [48 (link)]. For the deletion of MaAts, the upstream and downstream sequences of the MaAts gene were amplified with primer pairs MaAts-LF/MaAts-LR and MaAts-RF/MaAts-RR. The confirmed fragments were ligated to the pK2-PB vector to build pK2-PB-MaAts-LR (the targeted gene disruption vector). Then, the resulting vector was transformed into WT by A. tumefaciens mediated transformation. Nutrient-poor Czapek-Dox medium with phosphinothricin (500 μg/mL) was prepared to select fungal transformants. For the complementation of MaAts, the full length of MaAts (containing promoter 2.0-kb) was cloned with primer pair MaAts-HF/MaAts-HR. The fragment was ligated into pK2-sur vector to generate pK2-sur-MaAts. Then, it was transformed into ΔMaAts by A. tumefaciens mediated transformation. Nutrient-poor Czapek-Dox medium with chlorimuron ethyl (20 μg/mL) (Sigma-Aldrich, Bellefonte, PA, USA) was prepared to screen fungal transformants. All transformants were verified by PCR and Southern blotting. Primers used in this study are shown in Table S1 .
4
Chlorimuron-ethyl Degradation by Hansschlegelia sp.
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chlorimuron-ethyl and reagents used for chromatographic and spectroscopic analysis were all purchased from Sigma-Aldrich Chemical Co. (Shanghai, China). All other chemicals and solvents were of analytical grade. Strain Hansschlegelia sp. CHL1 was isolated in our previous research.
Phosphate-basal minimal medium (PBM) contained 0.5 g NaNO3, 1.0 g (NH4)2SO4, 2.5 g Na2HPO4, 1.0 g KH2PO4, and 1 mL of mineral solution per liter [12 (link)]. PBMM medium consisted of PBM supplemented with methanol (10 mL L-1).
Phosphate-basal minimal medium (PBM) contained 0.5 g NaNO3, 1.0 g (NH4)2SO4, 2.5 g Na2HPO4, 1.0 g KH2PO4, and 1 mL of mineral solution per liter [12 (link)]. PBMM medium consisted of PBM supplemented with methanol (10 mL L-1).
5
Isolation and Characterization of Chenggangzhangella methanolivorans
Check if the same lab product or an alternative is used in the 5 most similar protocols
Chenggangzhangella methanolivorans strain CHL1 was isolated from sludge samples collected from sewage treatment tanks at an agricultural chemical factory (Jiangsu Province, China) through enrichment, and had been identified and stored in our laboratory (8 (link)). All of the plasmids and strains used in this study are displayed in Table 1 .
The chlorimuron-ethyl and the reagents for the spectroscopic and chromatographic analyses were purchased from Sigma-Aldrich (Shanghai, China). All chemicals and analytical reagents were provided by TaKaRa Biotechnology (Dalian, China). The components of the mineral salt medium (MSM) were as follows: 2.0 g NaNO3, 0.5 g NaCl, 2.0 g KH2PO4, 0.02 g FeSO4·7H2O, 0.125 g MgSO4·7H2O, 0.2 g yeast extract, and 20 mL methanol per 1,000 mL of distilled water, pH 7.0.
+ Expand
The chlorimuron-ethyl and the reagents for the spectroscopic and chromatographic analyses were purchased from Sigma-Aldrich (Shanghai, China). All chemicals and analytical reagents were provided by TaKaRa Biotechnology (Dalian, China). The components of the mineral salt medium (MSM) were as follows: 2.0 g NaNO3, 0.5 g NaCl, 2.0 g KH2PO4, 0.02 g FeSO4·7H2O, 0.125 g MgSO4·7H2O, 0.2 g yeast extract, and 20 mL methanol per 1,000 mL of distilled water, pH 7.0.
6
Fungal Genetic Manipulation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
M. oryzae wild-type Guy-11 [40] and all its derivative transformants and mutants strains were routinely cultured on complete medium (CM) [41] (link) at 28°C for 3–14 days [42] (link). For genomic DNA isolation, mycelia were cultured in liquid CM for 3 days. Lipid medium, glucose medium and sodium acetate medium were prepared as described previously [33] (link). All fungal transformants were generated by Agrobacterium tumefaciens-mediated transformation (AtMT) as described previously [43] (link). CM plates containing 250 μg/ml hygromycin B (Roche, Mannheim, Germany), 200 μg/ml glufosinate–ammonium (Sigma, St Louis, MO, USA) or 800 μg/ml G418 (Sigma) and defined complex medium (DCM; 0.16% yeast nitrogen base without amino acids, 0.2% asparagine, 0.1% ammonium nitrate and 1% glucose, pH 6.0 with Na2HPO4) [8] (link) containing 100 μg/ml chlorimuron ethyl (Sigma) were used for screening corresponding transformants.
+ Expand
M. oryzae wild-type Guy-11 [40] and all its derivative transformants and mutants strains were routinely cultured on complete medium (CM) [41] (link) at 28°C for 3–14 days [42] (link). For genomic DNA isolation, mycelia were cultured in liquid CM for 3 days. Lipid medium, glucose medium and sodium acetate medium were prepared as described previously [33] (link). All fungal transformants were generated by Agrobacterium tumefaciens-mediated transformation (AtMT) as described previously [43] (link). CM plates containing 250 μg/ml hygromycin B (Roche, Mannheim, Germany), 200 μg/ml glufosinate–ammonium (Sigma, St Louis, MO, USA) or 800 μg/ml G418 (Sigma) and defined complex medium (DCM; 0.16% yeast nitrogen base without amino acids, 0.2% asparagine, 0.1% ammonium nitrate and 1% glucose, pH 6.0 with Na2HPO4) [8] (link) containing 100 μg/ml chlorimuron ethyl (Sigma) were used for screening corresponding transformants.
7
Isolation and Characterization of Chenggangzhangella methanolivorans
Check if the same lab product or an alternative is used in the 5 most similar protocols
Chenggangzhangella methanolivorans strain CHL1 was isolated from sludge samples collected from sewage treatment tanks at an agricultural chemical factory (Jiangsu Province, China) through enrichment, and had been identified and stored in our laboratory (8 (link)). All of the plasmids and strains used in this study are displayed in Table 1 .
The chlorimuron-ethyl and the reagents for the spectroscopic and chromatographic analyses were purchased from Sigma-Aldrich (Shanghai, China). All chemicals and analytical reagents were provided by TaKaRa Biotechnology (Dalian, China). The components of the mineral salt medium (MSM) were as follows: 2.0 g NaNO3, 0.5 g NaCl, 2.0 g KH2PO4, 0.02 g FeSO4·7H2O, 0.125 g MgSO4·7H2O, 0.2 g yeast extract, and 20 mL methanol per 1,000 mL of distilled water, pH 7.0.
+ Expand
The chlorimuron-ethyl and the reagents for the spectroscopic and chromatographic analyses were purchased from Sigma-Aldrich (Shanghai, China). All chemicals and analytical reagents were provided by TaKaRa Biotechnology (Dalian, China). The components of the mineral salt medium (MSM) were as follows: 2.0 g NaNO3, 0.5 g NaCl, 2.0 g KH2PO4, 0.02 g FeSO4·7H2O, 0.125 g MgSO4·7H2O, 0.2 g yeast extract, and 20 mL methanol per 1,000 mL of distilled water, pH 7.0.
8
Culturing and Genetic Manipulation of Magnaporthe oryzae
Check if the same lab product or an alternative is used in the 5 most similar protocols
M. oryzae wild type Guy11 [47 ] and all transformants were routinely cultured on complete medium (CM) at 28°C for 3 to 14 days [48 (link),49 (link)]. To isolate genomic DNA, the fungus was cultivated in liquid CM for 3 days. Lipid medium, glucose medium and sodium acetate medium were prepared as described [34 (link)]. All fungal transformants were generated by Agrobacterium tumefaciens-mediated transformation (AtMT) as described [50 (link)]. CM plates containing 250 μg/ml hygromycin B (Roche, Mannheim, Germany), 200 μg/ml glufosinate–ammonium (Sigma, St Louis, MO, USA) or 800 μg/ml G418 (Sigma) and defined complex medium (DCM; 0.16% yeast nitrogen base without amino acids, 0.2% asparagine, 0.1% ammonium nitrate and 1% glucose, pH 6.0 with Na2HPO4) [32 (link)] containing 100 μg/ml chlorimuron ethyl (Sigma) were used for screening the corresponding transformants. Cell wall integrity was tested by growing the strains on CM supplemented with 100 μg/ml Congo red. The tolerance of the strains to ROSs was evaluated by the growth on CM containing 2.5 or 5.0 mM H2O2 or 1 mM methyl viologen.
+ Expand
M. oryzae wild type Guy11 [47 ] and all transformants were routinely cultured on complete medium (CM) at 28°C for 3 to 14 days [48 (link),49 (link)]. To isolate genomic DNA, the fungus was cultivated in liquid CM for 3 days. Lipid medium, glucose medium and sodium acetate medium were prepared as described [34 (link)]. All fungal transformants were generated by Agrobacterium tumefaciens-mediated transformation (AtMT) as described [50 (link)]. CM plates containing 250 μg/ml hygromycin B (Roche, Mannheim, Germany), 200 μg/ml glufosinate–ammonium (Sigma, St Louis, MO, USA) or 800 μg/ml G418 (Sigma) and defined complex medium (DCM; 0.16% yeast nitrogen base without amino acids, 0.2% asparagine, 0.1% ammonium nitrate and 1% glucose, pH 6.0 with Na2HPO4) [32 (link)] containing 100 μg/ml chlorimuron ethyl (Sigma) were used for screening the corresponding transformants. Cell wall integrity was tested by growing the strains on CM supplemented with 100 μg/ml Congo red. The tolerance of the strains to ROSs was evaluated by the growth on CM containing 2.5 or 5.0 mM H2O2 or 1 mM methyl viologen.
9
Preparation of Potato Dextrose Agar and Reagents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Potato dextrose agar (PDA) and chlorimuron-ethyl were purchased from Sigma (St. Louis, MO, USA). Polypeptone, imidazole, Tris-HCl solution, kanamycin PMSF and IPTG were purchased from Sangon Biotechnology Incorporation (Shanghai, China). Yeast extract was purchased from Oxoid (England, UK). Sucrose (99.5%), MgSO4·7H2O (99%), KH2PO4 (99%), NaOH (96%), NaCl (99.5%) and trifluoroacetic acid (TFA, 99.5%) were purchased from China National Pharmaceutical Group Corporation (Shanghai, China). Acetonitrile (99.9%) was obtained from Astoon Chemical Technology Incorporation (Wilmington, DE, USA).
10
Overexpression of MaSom1 in Aspergillus tumefaciens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The MaSom1 coding sequence (2762 bp) was amplified according to the CQMa102 genomic DNA template with the primer pair MaSom1-F and MaSom1-R (Table S1 ) and inserted into the pK2-PgpdA-egfp vector, which contained the PgpdA promoter and the terminator TtrpC from A. nidulans, with XbaI/BamHI digested to produce the MaSom1-overexpression vector pK2-PgpdA-MaSom1::egfp. The pK2-PgpdA-egfp and pK2-PgpdA-MaSom1::egfp vectors were sequenced and mobilized into A. tumefaciens AGL-1 for fungal transformation [54 (link)]. The empty vector strains and the MaSom1-overexpression strains were screened on Czapek-dox agar medium (QDRS BIOTEC, Qingdao, China) with 20 μg/mL chlorimuron ethyl (Sigma, Bellefonte, PA, USA). The putative MaSom1-overexpression and the empty vector transformants were screened by PCR with the primer pairs of MaSom1-RF/EGFP-VR and PgpdA-VF/EGFP-VR, respectively (Table S1 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!