The plasmid (rAAV5-hSyn-eNpHR3.0-eYFP) was provided by courtesy of Karl Deisseroth’s Lab (Stanford University). We directly transfected plasmid-DNA into chemically competent Stbl3 E. coli cells (Invitrogen, Darmstadt, Germany) in order to amplify the plasmid containing the eNpHR3.0 construct. The vector possessed an ampicillin resistance. Therefore, transfected Stbl3 cells were transferred on Lysogeny broth (LB)-Agar with ampicillin (100 mg/ml) (Carl Roth GmbH, Karlsruhe, Germany) and incubated over night at 37°C. On the next day, we picked one colony and transferred it into 250 ml liquid LB-medium with 100 mg/ml ampicillin. After overnight incubation, we harvested bacterial cells by centrifugation at 4000 rpm for 15 min at 4°C and purified the plasmids with the Qiagen EndoFree Plasmid Maxi Kit (Qiagen, Hilden, Germany) according to the manufacturers’ protocol. We sent 300 μg of amplified plasmid for AAV vector production (serotype 2 pseudotyped with serotype 5) to the viral vector core at the University of North Carolina (UNC Vector Core, Chapel Hill, NC, USA) and received viral vectors with a titer of 4.0 × 1012 genome copies (g.c.) ml-1.
Stbl3 e coli cells
Manufactured by Thermo Fisher Scientific
Sourced in Germany, United States
Stbl3 E. coli cells are a strain of Escherichia coli bacteria commonly used in molecular biology laboratories. They are designed to maintain and propagate plasmid DNA with high stability and reliability.
Automatically generated - may contain errors
Lab products found in correlation
Plv ef1a ires puro vector, by Addgene (2 mentions)
Maxiprep, by Qiagen (2 mentions)
Sequence manipulation suite, by Integrated DNA Technologies (2 mentions)
Codon optimization tool, by Integrated DNA Technologies (2 mentions)
Lysogeny broth agar, by Carl Roth (1 mentions)
Ampicillin, by Carl Roth (1 mentions)
Endofree plasmid maxi kit, by Qiagen (1 mentions)
Pmd2 g, by Addgene (1 mentions)
Pcdh cmv mcs ef1 gfp lentiviral vector, by System Biosciences (1 mentions)
Pcdna3.1 v5 his topo vector, by Thermo Fisher Scientific (1 mentions)
Pbabepuro erbb2, by Addgene (1 mentions)
T4 polynucleotide kinase, by New England Biolabs (1 mentions)
Plasmid dna mini kit 1, by Omega Bio-Tek (1 mentions)
T4 dna ligase, by New England Biolabs (1 mentions)
Oligonucleotide, by Integrated DNA Technologies (1 mentions)
E z n a, by Omega Bio-Tek (1 mentions)
Plvx tetone puro vector, by Takara Bio (1 mentions)
Lenticrispr v2 vector, by Addgene (1 mentions)
Gibson assembly master mix, by New England Biolabs (1 mentions)
Gibson assembly, by New England Biolabs (1 mentions)
11 protocols using stbl3 e coli cells
1
Amplification and Purification of eNpHR3.0 Plasmid
2
Doxycycline-Inducible Lentivector Cloning of TF Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The parent plasmid for transcription factor gene cloning was a bicistronic doxycycline-inducible gene expression lentivector [56 (link)]. The gene-coding sequences of TFs SHOX2, TBX3, TBX5, TBX18 and the hyperpolarization-activated cyclic nucleotide-gated channel protein HCN2 were separately cloned into the same parent vector downstream of the seven tetracycline-responsive elements (binding its stable analog, doxycycline, Dox) and the minimal CMV promoter. All pDox-transgene plasmids were validated by sequencing. These plasmids, the plasmid for reverse Tet transactivator (rtTA2) and packaging plasmids psPAX2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259) were propagated in Stbl3 E. coli cells (Invitrogen, Carlsbad, CA, USA), extracted with the Qiagen Maxiprep kit, and quantified with the NanoDrop spectrophotometer.
3
Cloning of CX3CR1 Gene Construct
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primer CX3ATGKZF, designed to contain a Kozak consensus sequence, and primer CX3UTR2R (Figure S1 in Supplementary Material) were used for the amplification of a genomic fragment (2,494 bp in length) containing the whole CX3CR1 gene open reading frame (ORF) and a portion of the 3′UTR in which the two putative target sites for miR-27a-5p are included. The product was cloned in a pcDNA 3.1/V5-His-TOPO vector (Invitrogen), excised by XbaI-BamHI digestion, and ligated to an XbaI-BamHI digested pCDH-CMV-MCS-EF1-GFP lentiviral vector (System Biosciences).
Ligation product was transformed in Stbl3 E. coli cells (Invitrogen), a positive colony was selected by PCR, endotoxin-free plasmid DNA was extracted using the QIAfilter Plasmid Midi Kit with the EndoFree Plasmid Buffer Set (Qiagen), the whole insert and the flanking vector regions were sequenced using 16 primers (whose sequences are reported in Figure S1 in Supplementary Material).
Ligation product was transformed in Stbl3 E. coli cells (Invitrogen), a positive colony was selected by PCR, endotoxin-free plasmid DNA was extracted using the QIAfilter Plasmid Midi Kit with the EndoFree Plasmid Buffer Set (Qiagen), the whole insert and the flanking vector regions were sequenced using 16 primers (whose sequences are reported in Figure S1 in Supplementary Material).
4
Cloning and Sequencing of ERBB2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides (ordered from Integrated DNA Technologies; listed in S4 Table ) were phosphorylated with T4 Polynucleotide Kinase (NEB M0201S) and annealed. The lentiviral vectors pLKO.1 or pLKO.1_TET (both marked with Hygromycin B) were used to clone the annealed oligos into with T4 DNA Ligase (NEB M0202M). ERBB2 was PCR amplified from pBABEpuro-ERBB2 (Addgene #40978) using T4 PNK treated forward oligo (oACH_001) and a reverse oligo (oTM-795). The resulting PCR product was digested with NotI and inserted into pcDNA3β (gift from Ralph Scully) using EcoRV and NotI cut sites. The plasmids were transformed into Stbl3 E. coli cells (ThermoFischer, C737303) and selected for on LB + Carbenicillin plates. 5mL cultures of single colonies from plates were grown and plasmids extracted with Omega Biotek E.Z.N.A. Plasmid DNA Mini Kit I (D6942-00S). Plasmid sequences were verified via Sanger sequencing or whole plasmid sequencing performed by Plasmidsaurus using Oxford Nanopore Technology with custom analysis and annotation.
5
Plasmid Construction and Knockout Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids coding linker, poly-K, 102×GR and 102×PR in dual fluorescence stall reporter were prepared as described (17) . cDNA for 20×, 30×, 40×, 50×, 75× GR and PR, and 40× GA, GC, GD, GE, GF, GH, GI, GK, GL, GM, GN, GP, GQ, GS, GT, GV, GW, GY were synthesized and cloned into dual fluorescence stall reporter (GenScript). For knockout cell pools, sgRNA sequences targeting genes of interest were designed using Benchling software. They were cloned into lentiCRISPRv2 vector (a gift from Feng Zhang; Addgene plasmid # 52961) (20) using BsmBI restriction sites, as outlined in the protocol from Zhang lab (available at Addgene). For stable Tet-inducible cell lines, GFP-P2A-ChFP, GFP-P2A-poly-K and GFP-P2A-102×PR were cloned by restriction digestion and ligation and inserted into pLVX-TetOne-Puro vector (Takara Bio # 631849) using Gibson assembly. All cloned constructs were validated by sequencing. DNA preparations were made with Stbl3 E. coli cells (Thermo Fisher). The sequence information is available (Table S1).
6
Generating Spike Protein Lentivirus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Homo sapiens angiotensin-converting enzyme 2 (ACE2) transcript variant 2 amino acid sequence (NCBI Reference Sequence: NM_021804.3) was reverse translated using the Sequence Manipulation Suite and codon optimized using Integrated DNA Technologies’ Codon Optimization Tool. This fragment was synthesized as a gene block (IDT), with 5′-TTTTCTTCCATTTCAGGTGTCGTGAGGATCC added to the 5′ end and 5′- TGAGAATTCCTCGAGGGCGGCCGCTCTAGAGTC added to the 3′ end. This product was then inserted into the pLV-EF1a-IRES-Puro vector (Addgene Plasmid #85132) that had been digested with EcoRI and BamHI using Gibson Assembly (NEB). The sequence of the resulting construct was confirmed by Sanger sequencing and propagated in Stbl3 E. coli cells (Life Technologies) at 30°C followed by MaxiPrep (QIAGEN).
CMV-SARS-CoV-2-S was a kind gift from the Bieniasz Lab (Schmidt et al., 2020 (link)) and was used to generate pseudotyped lentivirus for infection of H522 cells. The various spike mutations were generated using PCR mutagenesis and cloned into CMV-SARS-CoV-2-S digested with AgeI and SpeI using Gibson Assembly Master Mix (NEB, #E2611). Primers used for cloning are listed inTable S7 .
CMV-SARS-CoV-2-S was a kind gift from the Bieniasz Lab (Schmidt et al., 2020 (link)) and was used to generate pseudotyped lentivirus for infection of H522 cells. The various spike mutations were generated using PCR mutagenesis and cloned into CMV-SARS-CoV-2-S digested with AgeI and SpeI using Gibson Assembly Master Mix (NEB, #E2611). Primers used for cloning are listed in
7
Second-Generation CAR-Like Construct Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We designed a second-generation CAR-like construct containing (1) two molecules of the SSA octreotide in the extracellular moiety, (2) CD8 as transmembrane domain and (3) CD3ζ and CD28 in the intracellular domain. The international patent application n. PCT/US21/35110 was filed on June 1, 2021. DNA was synthesized by IDT DNA (Coralville, Iowa, USA) using an optimization algorithm for codon usage in humans and cloned between the NcoI and NotI sites of a pMSGV1-28Z retroviral vector (insert reference PMID: 30 755 478). After transformation of Stbl3 E. Coli cells (Life Technologies, Darmstadt, Germany), ampicillin-mediated selection and Sanger sequencing of the CAR sequence, Phoenix-GP cells were transfected with the CAR-containing plasmid using Lipofectamine 3000 (Invitrogen, Carlsbad, California, USA) to produce intact retroviral particles. CD8+ T cells were then doubly transduced with 1:1 dilution of viral supernatant and expanded for 2 weeks in the presence of 300 IU of human recombinant IL-2 (Miltenyi Biotec).
8
ACE2 Protein Expression and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Homo sapiens angiotensin-converting enzyme 2 (ACE2), transcript variant 2 amino acid sequence (NCBI Reference Sequence: NM_021804.3) was reverse translated using the Sequence Manipulation Suite and codon optimized using Integrated DNA Technologies’ Codon Optimization Tool. This fragment was synthesized as a gene block (IDT), with 5’-TTTTCTTCCATTTCAGGTGTCGTGAGGATCC added to the 5’ end and 5’-TGAGAATTCCTCGAGGGCGGCCGCTCTAGAGTC added to the 3’ end. This product was then inserted into the pLV-EF1a-IRES-Puro vector (Addgene Plasmid #85132) that had been digested with EcoRI and BamHI using Gibson Assembly (NEB). The sequence of the resulting construct was confirmed by Sanger sequencing and propagated in Stbl3 E. coli cells (Life Technologies) at 30°C followed by MaxiPrep (Qiagen).
9
Cloning and Maintenance of Repeat Expansions
10
Lentiviral Transduction of Group 3 Medulloblastoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids targeting LIN28B (shLIN28B‐1 TRCN0000122191; shLIN28B‐5 TRCN0000219859), PBK (shPBK‐1 TRCN0000001806; shPBK‐2 TRCN0000001805), and corresponding control (shctl shc002; pLKO.1 lentiviral backbone empty vector) were purchased from Millipore Sigma (Merck KGaA, Dermstadt, Germany). LIN28B overexpression plasmid (LVLIN28B; Y3355) and control (LV105; EX‐Y3355‐Lv105) were purchased from Genecopoeia (Rockville, MD, USA). Plasmids were amplified in E.coli Stbl3 cells (Invitrogen, Carlsbad, CA, USA) following the manufacturer's protocols. After isolating plasmids using maxiprep technique, plasmids were packaged in lentivirus in HEK293T cells with pMD2.G, psPAX2 (Addgene, Watertown, MA, USA) following previously described protocols [4 (link), 7 (link)]. Briefly, 3 μg of each plasmid is added to 80% confluent HEK293T plates along with Fugene transfection reagent (Promega, Madison, WI, USA). Supernatant containing virus is collected at 48 and 72 h and then stored at −80 °C until viral transfection. On the day of infection, Group 3 MB cells are plated at low density on 6‐well plates and 4 mL aliquot of virus is added to media. Antibiotic selection is started after 72 h. For selection using puromycin, we used the following concentrations: 2 μg·mL−1 for BT52, BT52CTC, and HDMB03, 3 μg·mL−1 for D425, and 5 μg·mL−1 for D341.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!