Log In Sign up
The largest database of trusted experimental protocols

Megfp lifeact 7

Manufactured by Addgene
Visit Supplier

MEGFP-Lifeact-7 is a fluorescent protein construct that enables the visualization of actin filaments within live cells. It consists of the monomeric enhanced green fluorescent protein (MEGFP) fused to the Lifeact-7 peptide, which binds to filamentous actin. This product allows researchers to observe actin dynamics and organization in their studies.

Automatically generated - may contain errors

Lab products found in correlation

Lck gfp, by Addgene (1 mentions) Pegfp n1 human cofilin wt, by Addgene (1 mentions) Pmrfp n1 human cofilin wt, by Addgene (1 mentions) Collagen 1, by Roche (1 mentions)

6 protocols using megfp lifeact 7

1

RAP1 Mutant Expression Constructs

Cited 3 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Human RAP1A and RAP1B cDNA was cloned into the pK-FLAG plasmid or pEGFP-C3 plasmid (Clonetech), generating N-terminal tagged expression constructs. RAP1 G12V point mutations were introduced by site-directed mutagenesis (Agilent Technologies, 200521), using the following mutagenesis primers: RAP1A G12V for: CTAGTGGTCCTTGGTTCAGTAGGCGTTGGGAAGTCTGC, RAP1A G12V rev: GCAGACTTCCCAACGCCTACTGAACCAAGGACCACTAG, RAP1B G12V for: CTAGTCGTTCTTGGCTCAGTAGGCGTTGGAAAGTCTGC, RAP1B G12V rev: GCAGACTTTCCAACGCCTACTGAGCCAAGAACGACTAG. CFP_Gem_pcDNA4_HisMaxC was a gift from Henry Colecraft (Addgene plasmid # 4165350 (link)) and was cloned into the pK-FLAG plasmid. Dominant-negative RagB T54N, RagA QL, Rag C SN, mTOR-au1, Rheb, Rictor and Raptor expression constructs have been described previously47 (link),51 (link)–53 (link). pLAMP1-mCherry was a gift from Amy Palmer (Addgene 4514754 (link)) and TFEB-EGFP was kindly provided by Drs. Lewis Cantley and Mark Lundquist (Weill Cornell Medicine). mEGFP-Lifeact-7 was kindly provided by Michael Davidson (Addgene plasmid 54610). The mStrawberry-ATG4B-C74A construct30 (link) was a kind gift from Drs. Fahad Benthani and Yan Feng (MSKCC).
Mutvei A.P., Nagiec M.J., Hamann J.C., Kim S.G., Vincent C.T, & Blenis J. (2020). Rap1-GTPases control mTORC1 activity by coordinating lysosome organization with amino acid availability. Nature Communications, 11, 1416.
+ Open protocol
+ Expand
2

Plasmid Verification and Utilization

Check if the same lab product or an alternative is used in the 5 most similar protocols
All plasmids were acquired from Addgene and verified by sequencing using the associated primers on the Addgene website. The following plasmids were used: LCK-GFP (Addgene 61099), LCK-mScarlet-1 (Addgene 98821), pEGFP-N1 human cofilin WT (Addgene 50859), tdTomato-Lifeact-7 (Addgene 54528), mEGFP-Lifeact-7 (Addgene 54610), and pmRFP-N1 human cofilin WT (Addgene 50856).
Hylton R.K., Heebner J.E., Grillo M.A, & Swulius M.T. (2022). Cofilactin filaments regulate filopodial structure and dynamics in neuronal growth cones. Nature Communications, 13, 2439.
+ Open protocol
+ Expand
3

Generating PKC Beta II Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
pBabe-neo-TAZ (4SA), pBabe-neo-YAP (5SA) were described previously 20 (link), 21 (link) and generously provided by Kun-Liang Guan. pHACE-PKC alpha DN (21235), pHACE-PKC beta I DN (16381), pHACE-PKC beta II DN (16385) and pHACE-PKC gamma DN (21239) were described preciously 36 (link) and gifts from Bernard Weinstein via Addgene. mEGFP-Lifeact-7 (54610) was a gift from Michael Davidson via Addgene. To generate pHACE-PKC beta II wild-type, pHACE-PKC beta II DN (16385) was subjected to site-directed mutagenesis using the Quickchange mutagenesis Kit (Stratagene). To generate pBabe-puro-PKC beta II wild-type, HA-tagged PKC beta II wild-type from pHACE-PKC beta II wild-type was subcloned into the pBabe-puro vector.
Liu Z., Wei Y., Zhang L., Yee P.P., Johnson M., Zhang X., Gulley M., Xavier J., Trebak M., Wang H.G, & Li W. (2018). Induction of store operated calcium entry (SOCE) suppresses glioblastoma growth by inhibiting the Hippo pathway transcriptional coactivators YAP/TAZ. Oncogene, 38(1), 120-139.
+ Open protocol
+ Expand
4

Generating PKC Beta II Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
pBabe-neo-TAZ (4SA), pBabe-neo-YAP (5SA) were described previously 20 (link), 21 (link) and generously provided by Kun-Liang Guan. pHACE-PKC alpha DN (21235), pHACE-PKC beta I DN (16381), pHACE-PKC beta II DN (16385) and pHACE-PKC gamma DN (21239) were described preciously 36 (link) and gifts from Bernard Weinstein via Addgene. mEGFP-Lifeact-7 (54610) was a gift from Michael Davidson via Addgene. To generate pHACE-PKC beta II wild-type, pHACE-PKC beta II DN (16385) was subjected to site-directed mutagenesis using the Quickchange mutagenesis Kit (Stratagene). To generate pBabe-puro-PKC beta II wild-type, HA-tagged PKC beta II wild-type from pHACE-PKC beta II wild-type was subcloned into the pBabe-puro vector.
Liu Z., Wei Y., Zhang L., Yee P.P., Johnson M., Zhang X., Gulley M., Xavier J., Trebak M., Wang H.G, & Li W. (2018). Induction of store operated calcium entry (SOCE) suppresses glioblastoma growth by inhibiting the Hippo pathway transcriptional coactivators YAP/TAZ. Oncogene, 38(1), 120-139.
+ Open protocol
+ Expand
5

Visualizing Actin Dynamics with Fluorescent Probes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The anti-ITPKA antibody was purchased from Santa Cruz Biotechnology (sc-11206)), the vector encoding for LifeAct from Addgene (mEGFP-LifeAct-7, Addgene, #54610). SiR actin was from Spirochrome (CY-SC001), Collagen I from Roche (11179179001), Fura-2 from AAT Bioquest (21020), Ins(1,4,5)P3 from Buchem B. V. (D-1,4,5 IP3-Na-10 mg), and ATP from Carbosynth (NA00135).
Küster L., Paraschiakos T., Karakurt K.E., Schumacher U., Diercks B.P, & Windhorst S. (2023). The actin bundling activity of ITPKA mainly accounts for its migration-promoting effect in lung cancer cells. Bioscience Reports, 43(2), BSR20222150.
+ Open protocol
+ Expand
6

Analyzing Filopodia Formation in Engineered Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF-10A cells that constitutively carry both pHAGE-Zeocin-EGFP-LifeAct [mEGFP-LifeAct-7, Addgene plasmid # 54610)] and either pHAGE-Hygromycin-3XF-VRK1 or empty vector were generated via lentiviral transduction. These dually transduced cells were selected by growth in complete medium supplemented with Zeocin (100μg/ml) and Hygromycin (75μg/ml). Monolayers of confluent cells were wounded and monitored as above. The number of filopodia was scored in a blinded manner.
Mon A.M., MacKinnon AC J.r, & Traktman P. (2018). Overexpression of the VRK1 kinase, which is associated with breast cancer, induces a mesenchymal to epithelial transition in mammary epithelial cells. PLoS ONE, 13(9), e0203397.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!