Lenticrispr

The oligonucleotide sequence (5′- tttgaggcgaaagacaaagg-3′) for generation of small guide RNA (sgRNA) targeting the first exon of RNase L was selected from a published sgRNA database [34 (link)]. The lentiviral particles were prepared as described [35 (link)]. Briefly, a pair of oligonucleotides were synthesized and annealed, the plasmid Lenti-CRISPR (Addgene) was digested by BsmBI (NEB), the DNA fragments were inserted into the vector to generated plenti-CRIPSR-sgRL-6. The pseudo lentiviruses were packaged in 293T cells. Briefly, 1 × 10⁶ cells were plated in one well of 6-well plate, the next day cells were transfected with 5 μg of plenti-CRIPSR-sgRL-6, 3.5 μg psPAX2 and 1.25 μg of pCMV-VSV-G (a gift from Paul Bates, University of Pennsylvania) by Lipofectamine 2000 (24 μl in 250 μl of DMEM). The supernatants were harvested at 24 and 48 h post transfection, and were stored at −80°C.

L-02 cells (human hepatic cell line) were obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). FXR-null L-02 cells were generated by the CRISPR-Cas9 system, as described [23 (link)]. The targeting sgRNA sequences (NR1H4: 5′-TCCCTGCTGACGCGCCC ATG-3′) were subcloned into LentiCRISPRv2 (#49535, Addgene, USA). Recombinant LentiCRISPR plasmid was cotransfected with pCMV-VSV-G (#8454, Addgene, USA) and psPAX2 (#12260, Addgene, USA) into HEK293T cells to package infectious lentivirus. Medium-containing viruses were used to infect cells for 8 h and then selected in 0.5 μg/mL puromycin. Genomic DNA was isolated and amplified by PCR (forward: 5′-TTTGTTTTAGGCTTGTTAAC-3′, Reverse: 5′-TTGGACTAG AAATTCAGCTG-3′) followed by Sanger sequencing. Two independent FXR-null L-02 clones were selected for further analysis.

LentiCRISPR (Addgene, catalog no. 49535) was mutated at amino acid positions D10A and H840A by mutagenesis polymerase chain reaction (PCR) to construct Flag-dCas9-P2A-puro. Mouse TET1 catalytic domain (TET1CD) or p300CD was amplified from complementary DNA (cDNA) and subcloned into a MIGR vector. TET1CD or p300CD and internal ribosome entry site green fluorescent protein (IRES-GFP) sequences were amplified with a Gly–Gly–Gly–Gly–Ser linker and recombined into Flag-dCas9-P2A-puro instead of P2A-puro. Flag-dCas9-TET1CD or p300CD and IRES-GFP were recombined into pMXs-GW vectors. Amino acid sequences of each construct are detailed in the supplementary material (Additional file 1). For gRNA expression, DsRed was recombined into LentiCRISPR instead of Cas9-P2A-puro. Next, U6-gRNA-EFS-DsRed was recombined into CSII vector. Each gRNA expression vector was generated by the annealing of the oligonucleotides, followed by ligation into BsmBI-digested gRNA expression vectors based on CSII vector for lentiviral infection. In some cases, U6-gRNA-EFS-DsRed was recombined into pMXs-GW vectors for retroviral infection. gRNA off-target predictions were performed by CCTop—CRISPR/Cas9 target online predictor [41 (link)]. Max. total mismatches, core length, and max. core mismatches were set to 4, 12, and 2, respectively. Predicted off-target loci were listed in Additional file 2: Table S1.

sgRNAs were designed using web-based CRISPR design tool (http://crispr.mit.edu) and cloned into lentiCRISPR (Addgene Plasmid 49535 and 52961) and lentiGuidePuro (Addgene Plasmid 52963) as instructed19 (link)39 (link). lentiviral particles were made by transfecting 293FT cells with 2^nd generation packaging systems using lipofectamine 2000 (Life Technologies). iPSCs were singlized using Accutase (Millipore) and transduced with lentivirus in suspension in the presence of 8 μg/mL polybrene for two hours. The iPSCs/lentivirus mixture were diluted 1:1 in hESC medium and plated on DR4 MEF feeders at a low density, supplemented with 10 μM ROCK inhibitor, Y-27632, overnight. Attached cells were cultured in hESC medium for an additional 72 hours before drug selection using puromycin at 0.5 μg/mL during the first week and at 1 μg/mL during the second week. Puromycin-resistant iPSC colonies were individually picked into a new feeder well and screened for indels by sequencing genomic DNA.

Single gene knockout clones were generated in lentiCRISPRv2 (one vector system). The vector backbone was purchased from Addgene (lentiCRISPR v2 was a gift from Feng Zhang (Addgene plasmid # 52961; http://n2t.net/addgene:52961; RRID:Addgene_52961) ^{78 (link)}. The protocol for guide cloning and generation of the virus was as described in Sanjana et al.^{78 (link)}. The guide sequence for mouse TGFβ−1 KO is “CACCGTTGACGTCACTGGAGTTGTA” and non-targeting control (NTC) is “CACCAATATTTGGCTCGGCTGCGC”. The TGFβ−1 KO and control clones were selected using puromycin from Sigma (2ug/ml) in CT2A mouse glioma cell line. The TGFβ−1 KO was confirmed using western blotting (TGFβ−1 antibody from Abcam [EPR21143] (ab215715)).