The total RNA from the spleen was extracted using NcmZol reagent (NCM Biotech, China), following the manufacturer's protocol. The nucleic acid spectrophotometer (Eppendorf, Germany) was used to determine the RNA concentration and purity at 260 nm and 280 nm (A260/280 ¼ 1.80 À 2.00). Reverse transcription to complementary DNA (cDNA) was carried out using PrimeScript TM reverse transcription reagent kit with gDNA eraser (Takara Bio Inc, Japan) according to manufacturer's protocol. A total of 20 mL reaction mix, constituting 2 mL of 5x diluted cDNA template, 0.8 mL of each forward and reverse primer, 10 mL of TB Green TM Premix ExTaq TM (Takara Bio Inc, Japan), 0.4 mL of ROX reference Dye II and 6 mL DEPC water was used to perform Real-time PCR was on ABI QuantStudio 5 Real-Time PCR Instrument (Applied Biosystems, ThermoFisher Scientific, United States). Primers used for qRT-PCR were based on published target sequences (Table S1). Primers were normalized against the mRNA level of 18-S as an internal control and the CON þ Saline group was used as calibrator. Thermal cycling was initiated with an initial denaturation stage of 30 s at 95 � C, followed by 40 cycles of 95 � C for 5 s and 60 � C for 30 s, and the dissociation stage. The relative mRNA expression of the target genes was analyzed using the 2 À DDCT method.
Primescript reverse transcription reagent kit with gdna eraser
Manufactured by Takara Bio
Sourced in Japan
The PrimeScript Reverse Transcription Reagent Kit with gDNA Eraser is a laboratory equipment product designed for the reverse transcription of RNA into cDNA. The kit includes reagents for the removal of genomic DNA and the synthesis of first-strand cDNA from total RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Isopropanol, by Tianjin Damao (3 mentions)
Chloroform, by Tianjin Damao (3 mentions)
Ethanol, by Tianjin Damao (3 mentions)
Sybr green, by Takara Bio (2 mentions)
Abi quantstudio 5 real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Tb green premix ex taqtm, by Takara Bio (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Evolution 350 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Tb green premix ex taq quantitative tli rnaseh plus, by Takara Bio (1 mentions)
Abi 7900 sequence detection system, by Thermo Fisher Scientific (1 mentions)
7900 real time pcr system, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Rnawait, by Solarbio (1 mentions)
Ficoll lymphocyte separation medium, by Merck Group (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Tb green premix ex taq 2, by Takara Bio (1 mentions)
Phorbol 12 myristate 13 acetate, by Merck Group (1 mentions)
Applied biosystems 7500, by Thermo Fisher Scientific (1 mentions)
P nf κb p65, by Cell Signaling Technology (1 mentions)
11 protocols using primescript reverse transcription reagent kit with gdna eraser
1
Spleen Total RNA Extraction and qRT-PCR Analysis
2
Testicular Cells RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from testicular cells using RNAiso Plus following the manufacturer's protocol (TaKaRa, Dalian, China). To obtain cDNA, the PrimeScriptTM Reverse Transcription Reagent Kit with gDNA Eraser (TaKaRa) was used with random primers (Invitrogen). The sequences of the specific primers used for PCR are listed below:
Mpp2ca-P5F: GGTCAAGAGCCTCTGCGAGAA; Mpp2ca-P5R1: CCGGTCATGGCACCAGTTAT.
Mpp2ca-P5F: GGTCAAGAGCCTCTGCGAGAA; Mpp2ca-P5R1: CCGGTCATGGCACCAGTTAT.
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In accordance with the manufacturer’s recommendations, TRIzol reagent (Invitrogen) was used to extract total RNA from PC parent cells (PANC-1 and AsPC-1), drug-resistant tissues, and resistant cells (PANC-1-G/R and AsPC-1-G/R). Total RNA was quantified using an Evolution 350 spectrophotometer (Thermo Fisher Scientific). The PrimeScript Reverse Transcription Reagent Kit with gDNA Eraser (TaKaRa, RR047A) was used for reverse transcription. qPCR was performed using TB Green®Premix Ex Taq Quantitative (Tli RNaseH Plus) (TaKaRa, RR420A). For each sample, gene expression levels were normalised to those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and calculated using 2−ΔΔct.
4
Quantitative Analysis of SPRED1 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from mononuclear cells of bone marrow samples using the TRIzol reagent (TaKaRa, Japan) and reverse transcribed using a PrimeScript Reverse Transcription Reagent Kit with gDNA Eraser (Perfect Real Time, TaKaRa) according to the manufacturer's protocol. The integrity of synthesized cDNA was confirmed using β-actin as the endogenous control.
Quantitative reverse transcription polymerase chain reaction (PCR) was performed using 7900 real-time PCR system and SYBR Green (TaKaRa) as a double-stranded DNA-specific dye. Target genes were amplified with primers designed by Invitrogen (Shanghai, China). Specific primer sequences of SPRED1 were as follows: forward: 5'-GATGAGCGAGAGACGGAGAC-3' and reverse: 5'-GTCTCTGAGTCTCTCCACGGA-3'. The following protocol was used for real-time PCR: 1 cycle at 95°C for 30 s, followed by 40 cycles at 95°C for 5 s and 60°C for 34 s, and then 1 cycle at 95°C for 15 s, 60°C for 1 min, 95°C for 15 s, and 60°C for 15 s. A melting curve was generated for every PCR amplicon to check the specificity of the PCR reaction. The relative level of SPRED1 was analyzed using the ABI 7900 Sequence Detection System (Applied Biosystems, CA, USA) and calculated using the 2-ΔΔCt method.
Quantitative reverse transcription polymerase chain reaction (PCR) was performed using 7900 real-time PCR system and SYBR Green (TaKaRa) as a double-stranded DNA-specific dye. Target genes were amplified with primers designed by Invitrogen (Shanghai, China). Specific primer sequences of SPRED1 were as follows: forward: 5'-GATGAGCGAGAGACGGAGAC-3' and reverse: 5'-GTCTCTGAGTCTCTCCACGGA-3'. The following protocol was used for real-time PCR: 1 cycle at 95°C for 30 s, followed by 40 cycles at 95°C for 5 s and 60°C for 34 s, and then 1 cycle at 95°C for 15 s, 60°C for 1 min, 95°C for 15 s, and 60°C for 15 s. A melting curve was generated for every PCR amplicon to check the specificity of the PCR reaction. The relative level of SPRED1 was analyzed using the ABI 7900 Sequence Detection System (Applied Biosystems, CA, USA) and calculated using the 2-ΔΔCt method.
5
Mtb H37Rv Infection of THP-1 Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
Mtb standard strain H37Rv (ATCC 27294) was preserved by the laboratory. THP-1 human macrophages were purchased from the Shanghai Institute of Cell Research, Chinese Academy of Sciences. Phorbol-12-myristate-13-acetate (PMA) and Ficoll lymphocyte separation medium were purchased from Sigma (USA). The RPMI-1640 medium, fetal bovine serum, and phosphate-buffered saline (PBS) were obtained from BI (Israel). Trizol was purchased from Invitrogen (USA). Chloroform, isopropanol, and ethanol were purchased from Damao Chemical Reagent Factory (China). DNase/RNase-free double-distilled water and RNAwait were obtained from Solarbio (China). The PrimeScript reverse transcription reagent kit with gDNA Eraser and TB Green Premix Ex Taq II were purchased from TaKaRa (Japan).
+ Expand
Mtb standard strain H37Rv (ATCC 27294) was preserved by the laboratory. THP-1 human macrophages were purchased from the Shanghai Institute of Cell Research, Chinese Academy of Sciences. Phorbol-12-myristate-13-acetate (PMA) and Ficoll lymphocyte separation medium were purchased from Sigma (USA). The RPMI-1640 medium, fetal bovine serum, and phosphate-buffered saline (PBS) were obtained from BI (Israel). Trizol was purchased from Invitrogen (USA). Chloroform, isopropanol, and ethanol were purchased from Damao Chemical Reagent Factory (China). DNase/RNase-free double-distilled water and RNAwait were obtained from Solarbio (China). The PrimeScript reverse transcription reagent kit with gDNA Eraser and TB Green Premix Ex Taq II were purchased from TaKaRa (Japan).
6
Comprehensive Western Blot and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blotting was performed as described previously (15 (link)). All the types of cells were lysed by RIPA buffer with cocktail protease and phosphatase inhibitors (Thermo Fisher Scientific). Total protein extracts (40 μg) were subjected to western blotting analysis with antibodies against the following proteins: ADAM9 (R&D system); p-EGFR (Tyr1068), EGFR, p-MAPK (Tyr202/204), MAPK, GAPDH, p-AKT (Ser473), AKT, p-IKKα/β (Ser176/180), IKKβ, p-NF-κBp65 (Ser536), NF-κBp65, p-IκBα (Ser32), IκBα, and β-actin (Cell Signaling, Massachusetts, USA).
Total RNA was extracted from all the types of cells by using TRIzol Reagent (Thermo Fisher Scientific) according to the vendor's instruction. The cDNA synthesis was achieved by using PrimeScript reverse transcription reagent Kit with gDNA Eraser (TaKaRa, Shiga, Japan). Quantitative PCR was performed with ADAM9 and GAPDH primers by using SYBR Green PCR Master Mix (Roche, Baden-Württemberg, Germany) in a real-time PCR System (Applied Biosystems 7500, Thermo Fisher Scientific). Primer sequences were as follows: ADAM9, 5′-CCTCGGGGACCCTTCGTGT-3′ and 5′-ATCCCATAACTCGCATTCTCTAAA-3′; GAPDH, 5′-CCACCCATGGCAAATTCCATGGCA-3′ and 5′-TCTAGACGGCAGGTCAGGTCCACC-3′. Quantitative analysis of RT-qPCR was achieved by the 2−ΔΔCt method.
Total RNA was extracted from all the types of cells by using TRIzol Reagent (Thermo Fisher Scientific) according to the vendor's instruction. The cDNA synthesis was achieved by using PrimeScript reverse transcription reagent Kit with gDNA Eraser (TaKaRa, Shiga, Japan). Quantitative PCR was performed with ADAM9 and GAPDH primers by using SYBR Green PCR Master Mix (Roche, Baden-Württemberg, Germany) in a real-time PCR System (Applied Biosystems 7500, Thermo Fisher Scientific). Primer sequences were as follows: ADAM9, 5′-CCTCGGGGACCCTTCGTGT-3′ and 5′-ATCCCATAACTCGCATTCTCTAAA-3′; GAPDH, 5′-CCACCCATGGCAAATTCCATGGCA-3′ and 5′-TCTAGACGGCAGGTCAGGTCCACC-3′. Quantitative analysis of RT-qPCR was achieved by the 2−ΔΔCt method.
7
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. RNA was converted to complemenatry (c)DNA using PrimeScript Reverse Transcription reagent kit with gDNA eraser (Takara Bio Inc., Otsu, Japan). The cDNA from was used for RT-qPCR analysis of IL-7. PCR primer pairs were as follows: IL-7 forward, 5′-CTGCAGTCCCAGTCATCAGTA-3′ and reverse, 5′-GTGGCACTCAGATGATGTGACA-3′ and β-actin forward, 5′-CCTGAGGCTCTTTTCCAGCC-3′ and reverse, 5′-AGAGGTCTTTACGGATGTCAACGT-3′ (25 (link)). Total IL-7 mRNA was measured using SYBR-Green reagents (Takara Bio Inc.) and run in triplicate on the Applied Biosystems 7500 fast real-time PCR Detection system (Thermo Fisher Scientific, Inc. Carlsbad, CA, USA), normalized to β-actin by employing the 2−∆∆Cq method (26 (link)). Thermocycling conditions were as follows: 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec, 59°C for 34 sec, 95°C for 15 sec, 60°C for 60 sec and 95°C for 15 sec.
8
Gene Expression Analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were collected by trypsinization, and the total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s protocol. cDNA was synthesized using the PrimeScript™ Reverse Transcription Reagent Kit with gDNA Eraser (Takara, Tokyo, Japan). The products were then used for analysis by the PRISM 7900 Sequence Detection System (Applied Biosystems Inc., Foster City, CA, USA) and the SYBR® Premix Ex Taq™ Kit (Takara). The samples were processed in triplicate and analyzed by the 2−ΔΔCt method. The primers were purchased from Sangon Biotech (Shanghai, China) and are listed in Table 1 .
9
Quantitative Analysis of FBXW7 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HKC cells using TRIzol reagent and reverse transcribed using RT primer mix and RT enzyme mix (PrimeScript™ reverse transcription reagent kit with gDNA Eraser, Takara Bio, Inc.) at 37°C for 15 min after quantification. Equal amounts of RT reaction product (2 µl) were subjected to PCR amplification and the SYBR-Green (Takara Bio, Inc.) qPCR method was used to determine FBXW7 mRNA expression. The thermocycling conditions were as follows: Initial denaturation for 3 min at 95°C, followed by 40 cycles of denaturation at 95°C for 5 sec, annealing at 55°C for 30 sec and extension at 72°C for 30 sec. The final extension was performed at 72°C for 10 min. GAPDH was used as a housekeeping gene. The results were analyzed using the 2−∆∆Cq method (17 (link)). The primers sequences are presented in Table I .
10
EBV Gene Expression in Akata Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Akata cells cocultured with S. sanguinis for 24 h were harvested and resuspended in TRIzol. RNA was extracted by a HiPure universal RNA minikit (Magen Tech, Guangzhou, China) according to the manufacturer’s protocol. RNA was reverse transcribed to cDNA by a PrimeScript reverse transcription (RT) reagent kit with gDNA Eraser (TaKaRa, Tokyo, Japan) prior to qPCR. The EBV genes BRLF1, BMLF1, BLLF1, BZLF2, BXLF2, BKRF2, BALF4, LMP1, LMP2A, and EBNA1 and the host gene, GAPDH (glyceraldehyde-3-phosphate dehydrogenase), were quantified. The amplification primers corresponding to these genes are shown in Table S9. Each PCR was performed containing 4 μL LightCycler 480 SYBR green I master mix (Roche, Basel, Switzerland), 1 μL each primer, 2 μL water, and 1 μL cDNA template and was performed on a Roche LightCycler 480. Samples were tested in duplicate. PCRs were performed with the following conditions: 5 min at 95°C, followed by 45 cycles of denaturation for 10 s at 95°C, annealing for 20 s at 58°C, and extension for 20 s at 72°C. The relative abundance of these assumed species was calculated by the 2−ΔΔCT method (ΔCT = CT values of EBV target genes − CT values of GAPDH).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!