R212 01

A genomic segment encompassing the variant c.2106 + 3A > T sequence along with flanking intronic sequences, including exon 13, part of intron 13–14, exon 14, intron 14–15 and exon 15, was PCR-amplified from patient genomic DNA. The segments containing the wild-type (WT, c.2106 + 3A) and mutant-type (MT, c.2106 + 3T) sequences were separately cloned into the minigene vector pMini-CopGFP (Hitrobio.tech, China). The following primers were used to construct the vectors using the ClonExpress® II One Step Cloning Kit (Vazyme Biotech Co., Ltd): DYNC2H1-AF, AAGCTTGGTACCGAGCTCGGATCCGTGGCACATTTTTATAATTCTATTGATC; DYNC2H1-AR, AAGAAGGCAGACAGCCATGGGGTTTCACCATGTTGG; DYNC2H1-BF, ATGGCTGTCTGCCTTCTTCATTCTTCCTTTCCG; DYNC2H1-BR, TTAAACGGGCCCTCTAGACTCGAGCTGTGCTTCTACAGTTGCTAAGCCAGTT. The correct wild-type and mutant Minigene plasmids were transfected into HEK293T cell line for 48 h. Total RNA was extracted, and cDNA synthesis was performed (R212-01, Vazyme Biotech Co., Ltd.). Real-time PCR was performed using the primers F-GGCTAACTAGAGAACCCACTGCTTA and R-CTGTGCTTCTACAGTTGCTAAGC, and the products were sequenced.

Total RNA was extracted from 293T cells using an RNA‐easy Isolation Reagent kit (R071; Vazyme Biotech, China). First‐strand cDNA was synthesized using (R212‐01, Vazyme Biotech). qPCR analysis was performed using SYBR Green Real‐Time PCR Master Mix (QPK‐201, Toyobo, Osaka, Japan) in a CFX Connect Real‐Time PCR System (Bio‐Rad, Hercules, CA, USA). Data were obtained via a standard curve analysis and normalized to an internal control gene (ACTB).