Primescript rt reagent

Total RNA was extracted from HCC tumour tissues and normal tissues using an RNA Extraction Kit (Qiagen, Germany) according to the manufacturer’s protocol. The RNA concentration of total RNA was measured by a NanoDrop spectrometer (Thermo Fisher Scientific). The RNA purity (optical density) of each sample was larger than 2.0. After that, RNA was reverse transcribed to obtain complementary deoxyribose nucleic acids (cDNAs) with PrimeScript RT Reagent (Vazyme Biotech Co. Ltd. Nanjing). The qRT-PCR protocol was conducted using Vazyme ChamQ SYBR qPCR Master Mix obtained from Vazyme Biotech Co. Ltd. (Nanjing, China). PCR was carried out as follows: initial denaturation at 95 °C for 30 s, followed by 40 cycles of 10 s at 95 °C and 30 s min at 60 °C, and a final extension at 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s (LightCycler Strep-A assay (Roche Applied Science, Indianapolis, Ind)). The mRNA expression levels of the target genes were quantified using the 2-ΔΔCq method [20 (link)] and normalized to GAPDH mRNA expression levels. The following primers were used: GAPDH F, 5’-TGCACCACCAACTGCTTAGC-3’ and R, 5’-GGCATGCACTGTGGTCATGAG-3’; DRD1 F, 5’-TGGCATGTGAAGCTCCTCTC-3’ and R, 5’-CCTGTCGATTGTCAGCAGGATTA-3’.

Total RNA from cell lines or tissues was extracted using the RNA-Quick Purification Kit (Yishan, Shanghai, China) following the manufacturer’s instructions. The RNA purity and concentration were measured by NanoDrop ND2000 (Thermo, USA). We synthesized cDNA using Primescript RT Reagent (Vazyme, China). Real-time PCR was conducted with a standard SYBR Green PCR kit (Vazyme, China) using the Thermal Cycler Dice Detection System (ABI 7900; Thermo, USA). The relative expression of target genes was calculated using GAPDH as the reference gene. The primers used for this study were listed in Table S3 . RIP was done using the Geneseed RIP kit (Geneseed, Guangzhou, China) according to the protocol provided. Antibodies used were anti-RBM10 (Novus, NB100-55265), anti-SRSF2 (Santa Cruz, SC-13,509), and IgG (Cell Signaling Technology, Cat No. 2729).

Quantity and quality of RNA were determined by NanoDrop-2000 spectrophotometer (NanoDrop Technologies, Wilmington, Delaware). RNA was reverse transcribed into cDNA using PrimeScript RT reagent (Vazyme R333-01) in a total volume of 10 ul. The following protocol was used: 50 °C for 15 min, 85 °C for 5 s. qPCR was performed using SYBR qPCR Master Mix (Vazyme Q712-02) by QuantStudio 7 Flex Real-Time PCR System. RPL13A was used as the reference gene. All the primers used are as follows: RP11-273G15.2-F: AGTGTATCACAGCCATTGGGA; RP11-273G15.2-R: AGGACGCTTCGGTCTCTGTA; IFIT1-F: CCACAAGACAGAATAGCCA; IFIT1-R: GCTCCAGACTATCCTTGACC; IFIT3-F: TTCACCTGGAACTTATTCAAG; IFIT3-R: TTTTATGTAGGCCAACAAGTT; MX1-F: GGGTAGCCACTGGACTGA; MX1-R: AGGTGGAGCGATTCTGAG; RPL13A-F: CCTGGAGGAGAAGAGGAAAGAGA; RPL13A-R: TTGAGGACCTCTGTGTATTTGTCAA. Gene expression was calculated using the 2^-ΔΔCt method.