After cultivation in MRS medium, the LP28 cells were collected by centrifugation. Plasmid DNA derived from the cells was extracted by the Genopure Plasmid Maxi Kit (Roche). The bacterial cells, which were suspended in a buffer containing lysozyme (Wako) and achromopeptidase (Wako) (each final concentration is 4 mg/ml), were incubated for 3 h at room temperature to make the cell lysate.
Genopure plasmid maxi kit
Manufactured by Roche
Sourced in Switzerland, United States
The Genopure Plasmid Maxi Kit is a laboratory equipment product designed for the purification of high-quality plasmid DNA from bacterial cultures. It provides a reliable and efficient method for the extraction and isolation of plasmid DNA, which is a crucial tool in molecular biology and genetic research.
Automatically generated - may contain errors
Lab products found in correlation
Achromopeptidase, by Fujifilm (1 mentions)
Lysozyme, by Fujifilm (1 mentions)
Lipofectamine ltx plus, by Thermo Fisher Scientific (1 mentions)
Pcr8 gw topo, by Thermo Fisher Scientific (1 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions)
Pmxs gw, by Addgene (1 mentions)
T4 dna ligase, by Thermo Fisher Scientific (1 mentions)
Bstbi, by New England Biolabs (1 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions)
6 protocols using genopure plasmid maxi kit
1
Plasmid DNA Extraction from LP28 Cells
2
NLK Overexpression Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human NLK cDNA clone was obtained from Sino Biological Inc (Beijing, China). The NLK coding sequence was amplified by PCR using the following primers: 5′-GAGCGGATAACAATTTCACACAGG-3′ (forward) and 5′-CGCCAGGGTTTTCCCAGTCACGAC-3′ (reverse). The resultant PCR fragment was cloned into the pcDNA3.1 expression vector using the HindIII and XbaI restriction sites. Proper insertion of the clone was confirmed by DNA sequencing, and the plasmid was prepared for transfection using the Genopure Plasmid Maxi Kit (Roche, Basel, Switzerland). Transfection was performed using the Lipofectamine LTX Plus (Invitrogen, Carlsbad, USA) according to the manufacturer’s protocol. Cells were grown to 70 % confluency in 6-well plates and transfected with pcDNA3.1-NLK vector (1 μg) or pcDNA3.1 vector (1 μg). Cells were harvested and used in further experiments 48 h following transfection.
3
Constructing Gene Delivery Systems
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For establishing distinct gene delivery systems, we amplified the CDS region of the hepatic reprogramming factors Hnf1a, Hnf4a, Gata4, and Foxa3 by Phusion High-Fidelity DNA Polymerase (Thermo Scientific). Amplified PCR products were inserted into the gateway cloning donor vector pCR8/GW/TOPO (Invitrogen) according to the manufacturer's instructions. The cloned CDS regions in the donor plasmids were transferred into the gateway destination plasmids by LR recombination. The gateway destination plasmids pCXLE-gw (Addgene #37626), pMXs-gw (Addgene #18656), and FU-tetO-gw (Addgene #43914) were used for the episomal, retroviral, and dox-inducible lentiviral gene delivery systems, respectively. For preparing transfection-quality plasmid DNA, cloned plasmid DNA was amplified and purified by the Genopure Plasmid Maxi Kit (Roche).
4
Generating Recombinant Varicella-Zoster Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DH10B E. coli containing the pOkaBAC (30 (link)) were transformed with plasmid pST76A-SR_ORF31_2096A and recA-mediated allelic exchange was carried out as described previously (71 (link)), resulting in pOkaBAC_ORF31_2096A. DH10B cells containing pOkaBAC_ORF31_2096A were transformed with plasmid pST76A-SR_ORF31_2096G, and pOkaBAC_ORF31_2096G was generated using the same procedure. pOkaBAC, pOkaBAC_ORF31_2096A, and pOkaBAC_ORF31_2096G were purified (Genopure Plasmid Maxi Kit; Roche Diagnostics), subjected to restriction fragment length polymorphism analysis using BamHI or EcoRI and the region used for allelic exchange was sequenced.
The purified BAC genome (1 μg) was mixed with PEImax solution (3 μL) prepared as described previously (79 (link)) and transfected to MRC-5 cells. After cytopathic effects were seen in cells expressing green fluorescent protein within the BAC cassette, cell-free virus was prepared as described above and used to infect MeWo_Cre cells to excise the BAC cassette using the Cre/loxP system, resulting in rpOka_gB699Q (from pOkaBAC_ORF31_2096A) and rpOka_gB699R (from pOkaBAC_ORF31_2096G).
The purified BAC genome (1 μg) was mixed with PEImax solution (3 μL) prepared as described previously (79 (link)) and transfected to MRC-5 cells. After cytopathic effects were seen in cells expressing green fluorescent protein within the BAC cassette, cell-free virus was prepared as described above and used to infect MeWo_Cre cells to excise the BAC cassette using the Cre/loxP system, resulting in rpOka_gB699Q (from pOkaBAC_ORF31_2096A) and rpOka_gB699R (from pOkaBAC_ORF31_2096G).
5
Construction of CD19-Targeting CAR Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The VHH-based CD19-redirected CAR cassette contained the coding sequences for a CD19-specific VHH along with CD8α, followed by the 4-1BB costimulatory domain and the CD3ζ signaling domain, all of which were synthesized by Genscript (Piscataway, NJ, USA). This construct was PCR-amplified using the following oligonucleotide primers 5’ GCTAGCATGGCCTTACCAGTG 3’ and 5’ TTCGAACTAGCGAGGGGGCAG 3’ as forward and reverse primers, respectively. The forward and reverse primers were designed to introduce NheI (New England Biolabs, MA, USA) and BstbI (New England Biolabs, MA, USA) restriction sites at the 5’ and 3’ end of the CAR construct, respectively. The resultant CAR construct was subcloned into the pLJM1-EGFP vector using the mentioned restriction enzymes and T4 DNA ligase (Thermo Fisher Scientific, MA, USA). Finally, plasmid extraction was carried out using the Geno pure Plasmid Maxi Kit (Roche; Cat No. #03143422001) as an endotoxin-free kit for large-scale plasmid DNA isolation with sufficient high-quality.
6
HAPLN1 Overexpression in RA-FLSs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For HAPLN1OE RA-FLSs experiments, HAPLN1 over-expression plasmid and its control were constructed and packaged by Ubigene Biosciences (Guangzhou, China). The stbl3 strain plasmid cytomegalovirus vector-infected cells were cultured in LB medium (QDRS Biotec, China) with 100 g/ml of ampicillin under 37°C, 225 rpm for 24 h. The HAPLN1OE plasmid vector and its negative control (NC) were then isolated with the Genopure Plasmid Maxi Kit (Roche, US). RA-FLS at 60-70% confluency was transfected with HAPLN1OE vector or its negative control with Lipofectamine™ 3000 reagent (Invitrogen). The effects of HAPLN1OE plasmid vector are shown in Supplementary Figure S2B
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!