Qiaquick pcr gel purification kit

The RT-PCR products of three selected samples (sharp bands) were excised from the gel, and their DNA was purified with QIAquick PCR gel purification kits (QIAGEN, Valencia, CA, USA) in accordance with the manufacturer’s guidelines. The purified DNA from PCR products of the selected samples was sequenced using the Sanger method, using Seqscape^® software for raw data analysis. The nucleotide sequences were then placed in GenBank (http://www.ncbi.nlm.nih.gov/Genbank accessed on 12 December 2020) with accession numbers MT878465 (KFS-Elhamoul-1 strain), MT878466 (KFS-Motobas-2 strain), and MT878467 (KFS-Elhamoul-3 strain), as shown in Table 3. ClustalW2 (https://www.ebi.ac.uk/Tools/msa/clustalw2/ accessed on 12 December 2020) was used for the analysis of the sequences. The output alignment files were used for phylogenic maximum-likelihood analysis, with 1000 repeat bootstrap tests in MEGA X software [42 (link)]. The obtained nucleotide and deduced amino acid sequences were aligned with other sequences from GenBank using the Clustal W algorithm of BioEdit software Version 7.1, with the Damietta6 strain as a reference strain [43 ].

The RT-PCR product of the selected sample (sharpest band) was removed from the gel. QIAquick PCR gel purification kits (QIAGEN, Valencia, CA, USA) were used for purification of DNA from the gel according to manufacturer’s instruction. The purified RT-PCR product was sequenced in an Applied Biosystems^® 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using Big Dye Terminator v3.1 Cycle Sequencing Kit’s (Applied Biosystems, Foster City, CA, USA). The obtained nucleotide sequences were deposited in GenBank (http://www.ncbi.nlm.nih.gov/Genbank, accessed on 13 August 2020) with accession number MT887290 and then analyzed by ClustalW2 (https://www.ebi.ac.uk/Tools/msa/clustalw2/, accessed on 13 August 2020). The ClustalW2 output files were aligned with other sequences from the GenBank database using MEGA X software (neighbor joining and maximum likelihood phylogenic trees constructed with 1000 repeat bootstrap tests) and the ClustalW algorithm of BioEdit software Version 7.1 [26 (link),27 ].

For PCR walking, primers were designed from the predicted Padi2β cDNA 5′ end. The following primers were used:
Padi2β_ex1_Forward: 5′ GAAAGCAGCCCCAAATAGAAGAT 3′;
Padi2_ex14_Reverse: 5′GAGGCTCTCATTGGACAGGA 3′;
Padi2_ex15_Reverse: 5′TCTTAAGGATGTCGCGGTTC 3′;
Padi2_ex16_Reverse: 5′AAGTTGGTACAACCCAGCCA 3′.
PfuUltra II fusion High-Fidelity DNA Polymerase (Agilent) was used to amplify cDNA fragments of Padi2β from an Olineu cDNA pool. The pairs of primers used were Padi2β_ex1_Forward with Padi2_ex14_Reverse,
Padi2β_ex1_Forward with Padi2_ex15_Reverse
Padi2β_ex1_Forward with Padi2_ex16_Reverse.
The PCR products were run in a 2% agarose gel and the expected size bands were cut from the gel under a UV light. The PCR products were extracted and purified using a QIAquick PCR gel purification kit (Qiagen 28794) and sent for sequencing.