Easy mutagenesis system kit

Manufactured by Transgene

Sourced in China

The Easy Mutagenesis System kit is a laboratory equipment designed for the purpose of introducing targeted genetic modifications. The kit provides the necessary reagents and protocols to facilitate the process of site-directed mutagenesis.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Abi 3730xl sequencer, by Thermo Fisher Scientific (1 mentions) Dual luciferase reporter assay system, by Promega (1 mentions)

Close spelling variants of this product

Easy Mutagenesis System (14 citations)

4 protocols using easy mutagenesis system kit

PPAR-α 3'UTR Regulation by miR-21

Check if the same lab product or an alternative is used in the 5 most similar protocols

A 396 bp PPAR-α-3ʹ-UTR containing the miR-21 binding site was ligated to the pmir-GLO vector. The restriction sites were specific to Xbal and Sal1. (PPAR-α-3ʹUTR-Forward, 5ʹ-GGGGT ACCATGGTGGACACGGAAAGC-3ʹ, PPAR-α-3ʹUTR-Reverse, 5ʹ-CGGGATCCTCAGTACATG TCCCTGTAGATCT-3ʹ).
The mutant primers were designed using the Easy Mutagenesis System kit (TransGen Biotech, Beijing, China). The primer sequences are as follows: (PPAR-α-3ʹUTR-mut1-Forward,5ʹ-AAAAAAAAAATCTGTTAGTTCATCGATCAAATTGCAGC-3ʹ, PPAR-α-3ʹUTR-mut1-Reverse, 5ʹ-TCG ATGAACTAACAGATTTTTTTTTTGGTTGTGTGTTT-3ʹ, PPAR-α-3ʹUTR-mut2-Forward, 5ʹ-CC CCCGCTCTGGACTGTCATATGTTTGCACCCGTGGTA-3ʹ, PPAR-α-3ʹUTR-mut2-Reverse, 5ʹ- AAACATATGACAGTCCAGAGCGGGGGTCTTGAGACTCT-3ʹ). The pcDNA3.1-PPAR-α expression vector was constructed and the PPAR-α CDS sequence was amplified by PCR. The restriction sites were specific to KpnI and BamH1. (pcDNA3.1-PPAR-α-Forward, 5ʹ-CGGTGACTTATCCTGTGGTCC-3ʹ, pcDNA3.1-PPAR-α-Reverse, 5ʹ-CCGCAGATTCTACATTCGATGTT- 3ʹ).

Guan C.Y., Tian S., Cao J.L., Wang X.Q., Ma X, & Xia H.F. (2020). Down-Regulated miR-21 in Gestational Diabetes Mellitus Placenta Induces PPAR-α to Inhibit Cell Proliferation and Infiltration. Diabetes, Metabolic Syndrome and Obesity: Targets and Therapy, 13, 3009-3034.

+ Open protocol

+ Expand

Cloning and Mutagenesis of MeCP2-3'UTR

Check if the same lab product or an alternative is used in the 5 most similar protocols

A 367 bp MeCP2-3′-UTR containing the miR-199a binding site was ligated to the pGL3 vector. The restriction sites were specific to Xbal and SpeI. (MeCP2-3′UTR-Forward, 5′- GACTAGTTCTCTCTGCTCTGACGGGATTTGT -3′, MeCP2- 3′UTR-Reverse, 5′- GCTCTAGATTCAGAAGCCATGTCCTCAGGT -3′).
The mutant primers were designed using the Easy Mutagenesis System kit (TransGen Biotech, China). The primer sequences are as follows: (MeCP2-3′UTR-mut- Forward, 5′- TATTAGAGGGGAAAAGCTGATTATTGAAGTCAGTTCTCAACAAT -3′, MeCP2-3′UTR-mut-Reverse, 5′- ATAATCAGCTTTTCCCCTCTAATATGTAATTTTAGA -3′). The PMSCV-puro- MeCP2 expression vector was constructed and the MeCP2 CDS sequence was amplified by PCR. The restriction sites were specific to XhoI and EcoRI. (PMSCVpuro- MeCP2-Forward, 5′- CGCGGATCGCCACCATGGTAGCTGGGATGTTAGGGCT -3′, PMSCVpuro- MeCP2- Reverse, 5′- CCGGAATTCTCAGCTAACTCTCTCGGTCACGG - 3′).

Guan C.Y., Cao J.L., Zhang L., Wang X.Q., Ma X, & Xia H.F. (2022). miR-199a Is Upregulated in GDM Targeting the MeCP2-Trpc3 Pathway. Frontiers in Endocrinology, 13, 917386.

+ Open protocol

+ Expand

Engineered Cel-CD Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Site-directed mutagenesis mutants were constructed using Easy Mutagenesis System Kit (TransGene). The primers Glu160Gln-Forward/Reverse were included 5′end overlap region, mutation site and 3′ end extension region. In a certain system, the target DNA vectors containing the cel-cd gene were amplified by PCR and the templates were digested by DMT enzyme. After purified by gel extraction, the target vectors containing the E160Q mutant and E160Q&E274Q mutant was obtained. The Gln in the active sites of Cel-CD (Gln160 and Gln274) were all mutated to Glu. All the resulting constructs were confirmed by DNA sequencing and hydrolytic activity determination.

Gao D., Wang S., Li H., Yu H, & Qi Q. (2015). Identification of a heterologous cellulase and its N-terminus that can guide recombinant proteins out of Escherichia coli. Microbial Cell Factories, 14, 49.

+ Open protocol

+ Expand

Investigating PON1 miR-616 Interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Following the isolation of DNA from the leucocytes in the blood samples, PCR was used to amplify the fragment containing the rs3735590 polymorphism. The PCR product was purified for direct sequencing on an ABI 3730xl sequencer (Applied Biosystems, Foster City, CA). Each test was repeated three times.
Luciferase assay PCR was used to amplify the 3'UTR of PON1 that harbors the binding site of miR-616. The PCR products were subsequently inserted into multiple sites of a pMIR-REPORT expression reporter vector (Ambion, Naugatuck, CT) in accordance with the manufacturer's instruction. An Easy Mutagenesis System kit (TransGen Biotech, Beijing, China) was used to mutate the 3'UTR of human PON1. In order to carry out the luciferase reporter assay, primary cells (CC genotype) were seeded into 48-well plates and co-transfected with 20 ng of pRL-TK and 400 ng of luciferase reporter vector using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). A Dual-Luciferase Reporter Assay System (Promega, Madison, WI) was used to detect the luciferase activity. Three independent experiments were carried out.

Lv M., Sun D, & Chen L. (2018). Identification of Prognostic Value of Rs3735590 Polymorphism in 3'-Untranslated Region (3'-UTR) of Paraoxonase 1 (PON-1) in Chronic Obstructive Pulmonary Disease Patients who Received Coronary Artery Bypass Grafting (CABG). Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 47(5).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!