North2south chemiluminescent detection kit

Southern blotting was carried out on a single mtpA transformant for confirmation of mtpA gene disruption. As shown in Fig. 2a, the hybridization probe was prepared by amplifying a part of the hph marker gene with primers 11–12 (Table 3) and labeled using a North2South chemiluminescent detection kit (Thermo Fisher Scientific). Genomic DNA of the transformant was digested by EcoRI and HindIII and hybridized with the probe. Southern blotting was then performed using Whatman Turboblotter transfer system (GE healthcare life sciences) and detected by using a Pierce Chemiluminescent Nucleic acid detection module Kit (Thermo scientific). The blot was imaged in Thermo ECL imager.

DNA was extracted from virus-infected cells at different times after infection, digested with Alw44I (Thermofisher), size fractionated by electrophoresis through a 0.8% agarose gel, and imaged using SYBR Gold stain. The DNA was transferred to a Biodyne B Nylon membrane, crosslinked with UV-light, hybridized, washed, and detected using a GE ImageQuant LAS-4000 imager. The biotin-labelled probes were prepared using PCR plus 5’ AGACACACGCTTTGAGTTTTG 3’ and 5’ GATTCTTCCTCCAAACAGTTAACG 3’ primers, as directed by a North2South chemiluminescent detection kit (Thermofisher). The bands detected in the digital gel images were quantitated using Fiji v.2.2.0 (https://imagej.nih.gov/ij) and the signal intensities plotted using Microsoft Excel (v16.57) and Graph Pad Prism (v9.3.1).