Log In Sign up
The largest database of trusted experimental protocols

Scrambled shrna

Manufactured by GeneCopoeia
Visit Supplier
Sourced in United States, China

Scrambled shRNA is a type of short hairpin RNA (shRNA) designed to lack a specific target sequence. It is commonly used as a negative control in RNA interference (RNAi) studies to help distinguish the effects of the experimental shRNA from non-specific effects.

Automatically generated - may contain errors

Lab products found in correlation

Lentiviral particles, by Genechem (1 mentions) Xfect transfection reagent, by Takara Bio (1 mentions) Her2 sirna, by Cell Signaling Technology (1 mentions) Mir 7 mimic, by GenePharma (1 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)

4 protocols using scrambled shrna

1

Characterizing HCC Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
HCC cell lines HepG2 and Huh-7 were gifts from obtained from Dr. C.M.W (HongKong University). MHCC97L and PLC were gifts from Dr. Z.Y. Tang (Fudan University). All cells were grown in a humidified incubator at 37°C with 5% CO2. shRNA that targets human IGF2BP2 or FEN1 (psi-LVRU6MP- IGF2BP2) and the scrambled shRNA were purchased from GeneCopoeia (Rockville, MD, USA). The following sequences were targeted to human IGF2BP2 or FEN1:
Pu J., Wang J., Qin Z., Wang A., Zhang Y., Wu X., Wu Y., Li W., Xu Z., Lu Y., Tang Q, & Wei H. (2020). IGF2BP2 Promotes Liver Cancer Growth Through an m6A-FEN1-Dependent Mechanism. Frontiers in Oncology, 10, 578816.
+ Open protocol
+ Expand
2

Lentiviral Transduction of MAEL in Gastric Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentiviral particles expressing the MAEL coding sequence or empty vector (GeneChem, Shanghai, China) were transduced into the gastric epithelial cell line GES-1, and puromycin was used for the selection and maintenance of the stable cells. The lentiviral particles expressing MAEL shRNA or scrambled shRNA (GeneCopoeia, Guangzhou, China) were used to infect the AGS and HGC-27 GC cell lines. The target sequence (GGAACTGGCCACCTATCTACT) for MAEL was described previously by Li et al. [13 (link)]. After infection, the cells were selected with hygromycin B.
Zhang X., Ning Y., Xiao Y., Duan H., Qu G., Liu X., Du Y., Jiang D, & Zhou J. (2017). MAEL contributes to gastric cancer progression by promoting ILKAP degradation. Oncotarget, 8(69), 113331-113344.
+ Open protocol
+ Expand
3

Atovaquone Reduces HER2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Approximately 0.2X106 SKBR3 and MCF-7HH cells were plated in 6 well plate and left overnight for attachment. Next day, cells were transfected with HER2 siRNA (Cell Signaling) as per manufacturer’s instructions using siPORT transfection reagent. After 8 hours of transfection, cells were treated with 20µM atovaquone for 72 h and the cell lysate was used for western blotting. In another experiment, HER2 shRNA and scrambled shRNA (Genecopoeia, Rockville, MD) were transfected in SKBR3 cells using Xfect Transfection reagent (Clonetech) as per manufacturer’s instructions. After 8 hours of transfection, cells were treated with 20µM atovaquone. After 72h of atovaquone treatment, cell lysate was analyzed by western blotting.
Gupta N, & Srivastava S.K. (2019). Atovaquone: An antiprotozoal drug, suppresses primary and resistant breast tumor growth by inhibiting HER2/β-catenin signaling. Molecular cancer therapeutics, 18(10), 1708-1720.
+ Open protocol
+ Expand
4

Transfection of miRNA and shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
miR-7 mimics and miRNAs negative control (NC) were purchased from GenePharma, Inc. HOXB13 specific shRNA (HOXB13-shRNA) and scrambled shRNA which was used as a negative control were purchased from GeneCopoeia, Inc. The transfections of plasmids (2.5 µg) and miRNAs (10 pmol) were carried out using Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the protocol. At 48 h following transfection, subsequent experimentation was performed.
Tan Z., Zhou P., Zhu Z., Wang Y., Guo Z., Shen M., Xiao Y., Shen W, & Wu D. (2021). Upregulated long non-coding RNA LincIN promotes tumor progression via the regulation of nuclear factor 90/microRNA-7/HOXB13 in esophageal squamous cell carcinoma. International Journal of Molecular Medicine, 47(5), 78.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!