Pgex 6p1 vectors

Full-length TRP32 was PCR amplified from E. chaffeensis genomic material and cloned into pGEX-6p1 vectors (GE Healthcare; Piscataway, NJ). The constructs were transformed into BL21 E. coli (Genlantis; San Diego, CA) for protein expression. Briefly, overnight cultures were diluted 1:20 in LB plus ampicillin (Amp) and grown for 3 h with agitation at 37°C then protein expression was induced by adding isopropyl-β-D-thiogalactoside (IPTG) to a final concentration of 0.5 mM and growing for another for 3–4 h at 37°C. Cells were then suspended in Tris-buffered saline with protease inhibitors (cOmplete mini, EDTA free) (Sigma), lysed by sonication, then cleared by centrifuging for 20 min at 12,000 g at 4°C. Cleared lysate was then added to washed Glutathione Sepharose 4B (GE) and recombinant proteins were purified according to the manufacturer's instructions.

Plasmids containing full-length SDCCAG3 have been described earlier23 (link). Full-length IFT88 cDNA was isolated from a human kidney cDNA library (Clontech, Saint-Germain-en-Laye, France) and subcloned into pcDNA3 vectors (Invitrogen, Darmstadt, Germany) containing an N-terminal myc- or EGFP-tag. SDCCAG3 GST-fusion proteins were generated by inserting the indicated sequence fragment into pGEX-6p-1 vectors (GE Healthcare, Munich, Germany).
Allstar negative control siRNA (cat no. 1027280), SDCCAG3 no.1 (cat no.SI04185888) and no.3 siRNA (cat no. SI00713013), mSDCCAG3 siRNA (Cat no. SI04945885) were purchased from Qiagen (Limburg, Netherlands). SDCCAG3 no.2 siRNA and IFT88 siRNA were synthesized from Dharmacon (Thermo Scientific, Waltham, MA, USA) using following sequences: SDCCAG3, r(AAUUCUAAGCUGAGAAGAAUU);mIFT88, r(AAGGCAUUAGAUACUUAUAAA)dTdT; hIFT88, r(CGACUAAGUGCCAGACUCAUU).