North2south kit

Natural isolates (Supplementary file 1) were generously shared by Dr. Justin Fay. DNA from these strains was isolated using a standard Hoffman and Winston preparation method, then probed by PCR and Southern blot (Amberg et al., 2005 ). Two pairs of primers were designed to amplify either REP1 or FLP1 (FLP1_F: CCACAATTTGGTATATTATG, FLP1_R: CTTTCACCCTCACTTAG, REP1_F: AATGGCGAGAGACT, REP1_R: CGTGAGAATGAATTTAGTA), the two best conserved coding regions of the plasmid, as previously described (Xiao et al., 1991a (link)). Only strains that showed negative PCR results for both sets of primers were further validated by chemiluminescent Southern blot using the Thermo North2South kit (17097). Briefly, whole genome DNA was digested, run on an agarose gel in TAE, transferred to membrane and probed with chemiluminescent probes created from digested endogenous 2μ plasmid collected from BY4741 by Zymoresearch yeast plasmid miniprep kit (D2004). Gels and blots were imaged on a Bio-Rad ChemiDoc.

For dot blots and gel electrophoresis, total RNAs from the desired sucrose gradient fractions (500 µL) were isolated by acid guanidinium thiocyanate-phenol-chloroform (AFPC) extraction using Invitrogen TRIzol reagent (Thermo Fisher, Waltham, MA, USA). The RNA concentrations were determined using spectrophotometry (for single-stranded RNA, one OD₂₆₀ corresponds to 40 µg/mL). RNA electrophoresis was performed using MOPS buffer (40 mM MOPS pH7, 10 mM Na acetate, and 1 mM Na EDTA), and the 2% agarose gel was loaded with 2 µg of each fraction’s RNA. For dot blots, 2 µg of RNAs were applied on Amersham Hybond-N + nylon membranes (GE Healthcare Life Sciences, Singapore) using a dot blot apparatus. After UV-fixation of the RNAs, the membrane was hybridized with the corresponding biotinylated oligonucleotides using reagents from a North2South kit (Thermo Fisher). Chemiluminescence was recorded using a ChemiDoc XRS+ system (Biorad, Hercules, CA, USA).

Southern blots were carried out using genomic DNA isolated from schizont-stage parasites at ∼2–5% parasitemia in a 30 ml, at 2% haematocrit culture using the QIAamp DNA blood mini kit (Qiagen). RBCs were lysed using a 0.1% saponin solution. Between 2 and 3 μg of genomic DNA was restriction enzyme digested overnight with PstI and EcoRI (New England Biolabs), and probed with a PfATP4 PCR product obtained using primers SMG291 and SMG292. The probe was labelled with biotin-11-dUTPs using the Pierce Biotin Random Prime kit (Thermo Scientific). Blots were processed using the TurboBlotter kit (Whatman) for transfer and the North2South kit (Thermo Scientific) for development.