For RT-PCR analysis of IL-27 messenger RNA (mRNA) expression, TRIzol reagent (Sangon Biotech, Shanghai, China) was used to isolate total RNA from PBMCs, which were derived from 160 randomly selected subjects (80 patients with sepsis and 80 healthy controls) or from the LPS stimulation experiments in vitro. Then a First Strand complementary DNA (cDNA) Synthesis Kit (Thermo Fisher Scientific) was used to convert the RNA into cDNA following the instructions of the manufacturers. Quantitative RT-PCR was conducted to detect the expression levels of IL-27 using the SYBR Green RT-PCR Kit (Takara). The human ACTB (β-actin) gene was used as a control in the quantitative RT-PCR analysis. The primer sequences used in this study were designed by Sangon Biotech with the Primer Premier 5.0 program (Applied Biosystems) as follows: IL-27: 5’ CGGAGGGAGTTCA CAGTCAG 3′ and 5′ CAGGTGAGATTCCGCAAAGC 3′; β-actin: 5′ TCCCTGGAGAAGAGCTACGA 3′ and 5′ AGCACTGTGTTGGCGTACAG 3′. Amplification was performed in a LightCycler480 sequence detector system (Roche Applied Science, Laval, QC, Canada) with 40 cycles of 5 s at 95 °C, 20s at 58 °C, and 1 min at 72 °C. The IL-27 mRNA expression was calculated using the 2-△△CT method with values normalized to β-actin expression.
Primer premier 5.0 program
Manufactured by Thermo Fisher Scientific
Sourced in Canada
Primer Premier 5.0 is a software program designed for the design and analysis of primers and probes for PCR (Polymerase Chain Reaction) experiments. The core function of the program is to assist researchers in the selection of optimal primer and probe sequences to be used in their molecular biology experiments.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480 sequence detector system, by Roche (2 mentions)
Sybr green rt pcr kit, by Takara Bio (2 mentions)
Trizol reagent, by Sangon (2 mentions)
First strand complementary dna cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
2 protocols using primer premier 5.0 program
1
Quantifying IL-27 mRNA Expression
2
Quantitative Analysis of Angiogenic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell culture was the same as the cell proliferation assay. For quantitative RT-PCR analysis of the mRNA expressions of SHH, SMO, Gli1, angiopoietin-1 (ANG-1), vascular endothelial growth factor (VEGFA), vascular endothelial growth factor receptor 2 (VEGFR2), basic fibroblast growth factor (BFGF), endothelial nitric oxide synthase (ENOS), von Willebrand factor (VWF) and platelet-endothelial cell adhesion molecule 1 (PECAM-1) genes, TRIzol reagent (Sangon Biotech, Shanghai, China) was used to isolate total RNA from HUVECs. Then, a First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) was conducted to convert the RNA into cDNA. Quantitative RT-PCR was performed to calculate the expressions of these genes using the SYBR Green RT-PCR Kit (Takara). The human GAPDH gene was set as a control in the quantitative RT-PCR analysis. The primers sequences used in this study were designed by Sangon Biotech with Primer Premier 5.0 program (Applied Biosystems) as presented in Table 1. Amplification was performed in a LightCycler480 sequence detector system (Roche Applied Science, Laval, Quebec, Canada) with 40 cycles of: 5 s at 95 C, 20 s at 58 C and 1 min at 72 C. The mRNA expressions of these genes were calculate using the 2 À᭝᭝CT method with values normalized to GAPDH expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!