Total RNA was isolated from glioma tissues with TRIZOL (Invitrogen). According to the manufacturer’s instructions, cDNA was synthesized by using HIScript® II Q RT SuperMix (#R233-01, Vazyme). qRT-PCR was performed by using ChamQ SYBR Master Mix (#Q311-02/03, Vazyme) on the Applied Biosystems StepOnePlusTM Real-Time PCR System. Results were normalized to the β-actin gene and calculated with the method (Total number of cycles/ΔCt). All primer sequences are listed in Supplementary Table 4
Chamq sybr master mix
Manufactured by Vazyme
Sourced in China, Switzerland
ChamQ SYBR Master Mix is a ready-to-use qPCR reaction mixture containing SYBR Green I dye and all the necessary components for real-time PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (4 mentions)
Lightcycler 96, by Roche (3 mentions)
Hiscript q rt supermix for qpcr, by Vazyme (3 mentions)
Total rna extraction reagent, by Vazyme (3 mentions)
Hiscript 2 q rt supermix, by Vazyme (2 mentions)
Real time pcr system, by Bioer (2 mentions)
Cell tissue total rna isolation mini kit, by Vazyme (2 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Nanodrop 3000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Easyscript first strand cdna synthesis supermix, by Transgene (1 mentions)
Eastep super total rna extraction kit, by Promega (1 mentions)
Hiscript 2 1st strand cdna synthesis kit, by Vazyme (1 mentions)
Hiscript 3 1st strand cdna synthesis kit, by Vazyme (1 mentions)
Viia 7 qpcr system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Hiscript 2 1st strand complementary dna synthesis kit, by Vazyme (1 mentions)
Hiscript cdna synthesis kit, by Vazyme (1 mentions)
Plant total rna extraction kit, by Sangon (1 mentions)
17 protocols using chamq sybr master mix
1
Quantifying Transcripts in Glioma Tissue
2
Quantifying Gene Expression via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using the Eastep® Super Total RNA Extraction Kit (Promega Corporation) according to the manufacturer's instructions. Following detection of the concentration and purity of the extracted RNA using a NanoDrop 3000 Spectrophotometer (Thermo Fisher Scientific, Inc.), total RNA was reverse transcribed into cDNA using EasyScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech Co., Ltd.). The conditions for RT were as follows: 37˚C for 10 min, followed by 85˚C for 5 sec and holding at 4˚C. Subsequently, qPCR was performed using ChamQ SYBR Master Mix (Vazyme Biotech Co., Ltd.) and a LightCycler 96 (Roche Applied Science). The following thermocycling conditions were used for the qPCR: Initial denaturation at 95˚C for 10 min; followed by 40 cycles of 95˚C for 10 sec, 60˚C for 60 sec and 95˚C for 15 sec. The sequences of the primers used in the present study were as follows: FOXA2 forward, 5'-CGACTGGAGCAGCTACTATGC-3' and reverse, 5'-ATGTACGTGTTCATGCCGTTC-3'; and GAPDH forward, 5'-CAGGAGGCATTGCTGATGAT-3' and reverse, 5'-GAAGGCTGGGGCTCATTT-3'. Data were analyzed using the 2-ΔΔCq method (26 (link)) and normalized to GAPDH.
3
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIZOL (Invitrogen), then reversely transcribed to cDNA with HiScript II Q RT SuperMix (Vazyme, R223-01) according to the manufacturer's instructions. PCR amplifications were conducted by using ChamQ SYBR Master Mix (Vazyme, Q311-02/03). The housekeeping genes Actin or GAPDH were used for normalization. The primer pairs for qRT-PCR were listed in Table S6 . Data are displayed as means ± SD from three independent experiments.
4
FaDu Cell Total RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of FaDu cells was extracted using the Cell/Tissue Total RNA Isolation Mini kit (Vazyme Biotech) according to the manufacturer’s instructions. A total of 2 ng of total RNA was reverse transcribed into complementary DNA (cDNA) using the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme Biotech). Quantitative polymerase chain reaction (qPCR) analysis was performed on a Real-Time PCR System (BIOER, Hangzhou, China) using ChamQ SYBR Master Mix (Vazyme Biotech). Primers used are shown in Table 1 . Experiments were performed in triplicate. GAPDH served as an internal reference. The thermo cycle conditions were as follows: denaturation at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 10 s, and extension at 60°C for 30 s. Data were analyzed using the 2–ΔΔCT method.
5
Total RNA Extraction and Quantitative PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was isolated using total RNA extraction reagent (R401-01, Vazyme, Nanjing) according to manufacturer's instructions [38 (link)]. Then, 1 μg RNA was reversed transcribed to cDNA using Hiscript Q RT SuperMix for qPCR (R122-01, Vazyme, Nanjing) as described by manufacturer's instructions. Quantitative PCR was performed using ChamQ SYBR Master Mix (Q311-02, Vazyme, Nanjing) in a LightCycler 96 (Roche, Risch-Rotkreuz, Switzerland) with the following conditions: 5 min at 95°C, followed by 40 cycles at 95°C for 30 s, 60°C for 40 s, and 72°C for 60 s [39 (link)].
6
Quantifying Expression of m6A Regulators in Tumor Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from tumor cells was extracted with Trizol (15596-026) (Invitrogen, Carlsbad, CA) and reverse transcribed using the HiScript III 1st Strand cDNA Synthesis Kit (R123-01, Vazyme, China). The qRT-PCR assay was performed using ChamQ SYBR Master Mix (Q311-02) (Vazyme, Nanjing, China). Relative expression of mRNA was calculated by normalization to ACTB as the endogenous control. At least three independent replicates were included for analysis. The primers used were listed as follows: METTL14: sense: 5’-GTTGGAACATGGATAGCCGC-3’; antisense: 5’-CAATGCTGTCGGCACTTTCA-3’; THBS1: sense: 5’-AGAATGCTGTCCTCGCTGTT-3’; antisense: 5’-TTTCTTGCAGGCTTTGGTCT-3’; YTHDF2: sense: 5’-AGCCCCACTTCCTACCAGATG-3’; antisense: 5’-TGAGAACTGTTATTTCCCCATGC-3’.
7
qRT-PCR Workflow for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using Trizol reagent (15596018) (Invitrogen, Carlsbad, CA) following the manufacturer's instructions, and cDNA was generated with iScript cDNA Synthesis Kit (170-8890) (BioRad, Hercules, CA). The qRT-PCR assay was performed using ChamQ SYBR Master Mix (Q311-02) (Vazyme, Nanjing, China) on ViiA 7 Q-PCR System (Applied Biosystems, Waltham, MA). All primers used in the present study were listed in Table S2
8
Quantification of TTN Isoforms in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of wild-type (WT) and mutant cells was extracted using the Cell/Tissue Total RNA Isolation Mini Kit (Vazyme Biotech) according to the manufacturer’s instructions. A total of 2 ng of total RNA was reverse transcribed into complementary DNA using the HiScript II 1st Strand complementary DNA Synthesis Kit (Vazyme Biotech). Quantitative polymerase chain reaction (PCR) analysis was performed on a Real-Time PCR System (BIOER, Hangzhou, China) using ChamQ SYBR Master Mix (Vazyme Biotech). Primers are shown as following: TTN Z-disk: TCTCTCATCTCAGCCTCGGT (Forward) and TCTCTCATCTCAGCCTCGGT (Reverse); TTN M-line: AGGAACTCCTCCTCCCCATC (Forward) and CTCGTGCTGGTTTCTTCCCT (Reverse); and HPRT: CCCAGCGTCGTGATTAGTGATG (Forward) and TTCAGTCCTGTCCATAATCAGTCC (Reverse). Each sample was performed in triplicate. HPRT served as an internal reference. The thermo cycle conditions were set as follows: denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 10 s and extension at 60 °C for 30 s. Data were analyzed using the 2-ΔΔCT method.
9
Quantitative Gene Expression Analysis in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the rice protoplasts or young leaves using the Plant Total RNA Extraction Kit (Sango Biotech Co. Ltd, Shanghai, China). Reverse transcription was performed with 1 μg using HiScript cDNA Synthesis Kit (Vazyme Biotech Co. Ltd, Nanjing, China) according to the manufacturer’s instruction. Quantitative PCR (qPCR) was performed using ChamQ SYBR Master Mix (Vazyme Biotech Co. Ltd, Nanjing, China). Each qPCR assay was replicated at least three times. The RLuc gene was used as an internal control for rice protoplasts and the rice Actin1 gene was used as the housekeeping gene for plant samples. The primers were listed in Supplementary Table 3
10
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol (Cat# T9424; Sigma Aldrich, St Louis, MO, United States). RNA was reverse-transcribed into cDNA using a Transcriptor First Strand cDNA Synthesis Kit (Cat# R323-01; Vazyme Biotech Co., Nanjing, China) according to the manufacturer’s protocol. RT-qPCR analysis was performed using a ChamQ SYBR Master Mix (Cat# Q311-03; Vazyme Biotech Co) and a LightCycler 480 QPCR System (Roche Holding AG). The results were normalized to the internal control β-actin. The primers used are shown in Table 2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!