Bioanalyser 2100 system

The bioinformatically-identified STRs were amplified in a single multiplex using 3–10 ng of genomic DNA per bird with each unlabelled primer at a final concentration of 0.2 μM. Barcoded sequencing libraries were prepared with the TruSeq PCR-free Library Preparation kit (Illumina) and quantified using both the 2100 BioAnalyser system (Agilent) and Qubit™ fluorometer (Invitrogen) with appropriate dsDNA high sensitivity assays. Based on a 550 bp average insert size, libraries were normalised to 4 nM, diluted, and denatured to a loading concentration of 12 pM with a 1% ΦX spike-in in accordance with the manufacturer’s recommendations. Paired-end sequencing was performed using 500 cycles on an Illumina/Verogen MiSeq FGx sequencer in “research use only” (RUO) mode using the machine’s “Generate FASTQ” workflow. Paired-end reads were merged with FLASH version 1.2.11/lo and alleles were called by FDSTools ([56] (link)).

Fresh blood was collected using PAXgene blood RNA tubes (Becton Dickinson, Oxford, UK) and RNA was extracted using the PAXgene Blood RNA kit (Qiagen). cDNA was synthesized using the QuantiTect Reverse Transcription kit (Qiagen) according to the manufacturer's instructions. We carried out a PCR using the FastStart Kit (Roche) and primers as follows: PIGQ-2F, CACGCAGTGAGGTGCTCTT; PIGQ-5R, GGGGACATGAGGTGGATGTA; CBL-8F, GAGATGGGCTCCACATTCC; CBL-11R, GAACTTGGGGCAGATACTGG. To size PCR products accurately, we used ‘on-chip-electrophoresis’ and ran 1 µl on a DNA 1000 v2.3 chip using the 2100 Bioanalyser system (Agilent). We expected WT RT-PCR products of 583 and 698 bp for NM_004204 (PIGQ) and NM_005188 (CBL), respectively. Sanger sequencing was used to confirm the identity of the aberrant bands.

NEB Next Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs) was performed to construct miRNA sequencing libraries. The quality of the libraries was evaluated by a Bioanalyser 2100 system (Agilent Technologies). Then, the single-stranded DNA molecules from denatured libraries were captured on Illumina flow cells and amplified in situ as clusters. A HiSeq 4000 sequencing system (Illumina) was used for sequencing for 50 cycles according to the manufacturer’s instructions. Cutadapt software (v1.9.3) was used to trim the adaptor sequences from the sequencing data and retain the adaptor-trimmed reads (> = 15 nt). The trimmed reads were merged and used to predict novel miRNAs with miRDeep2 software (v2.0.0.5) [22 (link)]. The alignment of the trimmed reads was used both miRBase (http://www.mirbase.org) to obtain known pre-miRNAs and Novoalign software (v3.02.12) (http://www.novocraft.com/main/index.php) for newly predicted pre-miRNAs. The primal expression levels of the miRNA were determined via the numbers of tags on each mature miRNA. The TPM (tag counts per million aligned miRNAs) method was used for the standardization of read counts.

A total amount of 5 μg RNA per sample was used as input material for the RNA sample preparations. Sequencing libraries were generated by the NEBNextR Ultra Directional RNA Library Prep Kit for Illumina R (NEB, United States) following the manufacturer’s recommendations. First-strand cDNA was synthesized using random hexamer primers and M-MuLV Reverse Transcriptase (RNaseH). Second-strand cDNA synthesis was subsequently performed using DNA polymerase I and RNase H. After adenylation of the 3′ ends of the DNA fragments, NEBNext adaptors with hairpin loop structures were ligated to prepare for hybridization. To preferentially select cDNA fragments of 150∼200 bp in length, the library fragments were purified with the AMPure XP system (Beckman Coulter, Beverly, United States). Then, PCR was performed with Phusion High-Fidelity DNA polymerase, universal PCR primers and Index (X) Primer. Finally, the products were purified (AMPure XP system), and the library quality was assessed using the Agilent Bioanalyser 2100 system.
Clustering of the index-coded samples was performed using a cBot Cluster Generation System using TruSeq PE Cluster Kit v3-cBot-HS (Illumina) according to the manufacturer’s instructions. After cluster generation, the libraries were sequenced on the Illumina HiSeq 4000 platform, and 150-bp paired-end reads were generated.

Ribo-Zero rRNA removal kits (Illumina) were used to exclude ribosomal RNA molecules (rRNA). RNA sequencing libraries were constructed with the TruSeq Stranded Total RNA Library Prep Kit (Illumina) following the manufacturer’s instructions, and the quality was evaluated by a Bioanalyser 2100 system (Agilent Technologies). Then, single-stranded DNA molecules were clustered and sequenced for 150 cycles on an Illumina HiSeq 2500 sequencing system (Illumina). Finally, paired-end reads were acquired from the Illumina HiSeq sequencer, and quality control was performed with Q30. Removal of 3′ adaptor‐trimming and low‐quality reads was conducted on Cutadapt software (v1.9.3). Alignment of the high-quality clean reads with the human reference genome (UCSC hg19) was performed on hisat2 (v2.0.4) software (http://ccb.jhu.edu/software/hisat2/index.shtml).
Additionally, cuffdiff software (part of cufflinks) was used to determine the FPKM (fragments per kilobase of exon per million fragments mapped) as the expression profiles of mRNAs and lncRNAs with the guidance of the gtf gene annotation file.

Total RNA was isolated from heads of each honey bee sample using TRIzol reagent (Invitrogen, USA). The quality and quantity of the RNA was assessed by the RNA Nano 6000 Assay Kit of the Bioanalyser 2100 system (Agilent Technologies, CA, USA). Three μg of RNA per honey bee sample was used as input material for RNA sample preparations. After removing the ribosomal RNA and rRNA-free residue, we used rRNA-depleted RNA to construct sequencing libraries using a NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, USA). M-MuLV Reverse Transcriptase, DNA Polymerase I and RNase H were used to obtained the first and the second strand cDNAs respectively. NEBNext Adaptor with a hairpin loop was ligated for hybridization. Finally, the products were purified using AMPure XP system (Beckman Coulter, Beverly, USA), and library quality was assessed with the Agilent Bioanalyser 2100 system. Our libraries were sequenced on an Illumina Hiseq 2500 platform.

Sample preparation and processing was performed according to the Affymetrix GeneChip Expression Analysis Manual (http://www.Affymetrix.com). Total RNA was isolated from HUVECs using Trizol-Reagent (Life Technologies, Inc., Rockville, MD, USA). DNase treatment was carried out, using RNase free DNase I (Ambion, Woodward, Austin, TX, USA). RNA concentration and quality were assessed by RNA 6000 nano assays on a Bioanalyser 2100 system (Agilent, Waldbronn, Germany). 5 µg of RNA was converted into cDNA using T7-(dT)24 primers and the SuperScript Choice system for cDNA synthesis (Life Technologies, Inc., Rockville, MD, USA). Biotin-labelled cDNA was prepared by in vitro transcription using the BioArray high yield RNA transcript labeling kit (Enzo Diagnostics, Farmingdale, NY, USA). The resulting cDNA was purified, fragmented and hybridized to U133A gene chips (Affymetrix, Santa Clara, CA, USA). After hybridization the chips were stained with streptavidin–phycoerythrin (MoBiTec, Goettingen, Germany) and analysed on a GeneArray scanner (Hewlett Packard Corporation, Palo Alto, CA, USA).