Kyse150
KYSE150 is a laboratory equipment device. It is used for cell culture applications.
Lab products found in correlation
17 protocols using kyse150
Investigating circPOLR1C's Role in Esophageal Cancer
Cultivation of Esophageal Cancer Cell Lines
Culturing Esophageal Cancer Cell Lines
Treg Cell Adhesion to Lymphatic Endothelial Cells
ESCC Samples and Cell Lines
RT-qPCR and Protein Analysis of ZPR1 in ESCC
The total RNA was extracted using TRIzol (LEAGENE) from cell lines in the logarithmic growth phase and in good growth condition, and was inverted into cDNA using the RevertAid First Strand cDNA Synthesis Kits (Novoprotein). Gene‐specific primers used for RT‐qPCR were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primers for ZPR1 were 5′‐CGC CTCCT GCTC ACCA AGATTC‐3′ (forward) and 5′‐CCGACTGGATCTC CGTGTTGTTC‐3′ (reverse), and for GAPDH were 5′‐CGGAGTCAACGGATTTGGTCGTAT‐3′ (forward) and 5′‐AGCCT TCTCCATG GTGGTGAAGAC‐3′ (reverse). The total proteins were extracted using RIPA lysis buffer and PMSF protease inhibitor (Solarbio), and the bicinchoninic acid (Dingguo) method was used to determine the concentration of total proteins, and then equal amounts of protein were loaded and separated using SDS‐PAGE.
Culturing Esophageal Cancer Cell Lines
Esophageal Cancer Cell Line Protein Expression
Culturing Human Esophageal Squamous Cell Carcinoma Lines
Esophageal Cancer Cell Lines Investigation
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!