The largest database of trusted experimental protocols

17 protocols using kyse150

1

Investigating circPOLR1C's Role in Esophageal Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
In order to clarify the effect of circPOLR1C on the biological function of EC cells, we purchased human esophageal normal cell line Het-1A (ATCC® CRL-2692™, American Type Culture Collection) and various EC cell lines (KYSE-30, CL-0577, Procell, China; KYSE150, CL-0638, Procell, China; KYSE-220, laboratory preserved; TE-9, laboratory preserved; and EC9706, MZ-1077, MingZhouBio, China) and carried out differential expression research. According to the instructions of the manufacturer, cells were cultured with their specific complete cell culture media as follows: Het-1A cells were cultured in BEGM™ bronchial epithelial cell growth medium (CC-3171, Lonza/Clonetics Corporation, Switzerland) containing fetal bovine serum (FBS, 10%, SFBS, Bovogen, Australia); KYSE-30, KYSE150, KYSE-220, and TE-9 cells were maintained in RPMI-1640 medium (PM150110, Procell, China) supplemented with Ham's F-12 nutrient mixture (PM150810, Procell, China), FBS (10%), and penicillin-streptomycin solution (P/S, 1%, PB180120, Procell, China); EC9706 cells were grown in high-sugar Dulbecco's modified Eagle's medium (DMEM, C11995500BT, Gibco, USA) blended with FBS (10%) and P/S (1%). All cells were cultivated in a 5% MCO-20AIC CO2 incubator (SANYO, Japan) at 37°C.
+ Open protocol
+ Expand
2

Cultivation of Esophageal Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Normal human esophageal epithelial cells (Het-1A) and EC cell lines, including TE-10, KYSE150 and TE-1 cells, were purchased from Procell (Wuhan, China). EC cell line (KYSE450) was obtained from Cobioer Bioscience (Nanjing, China). All types of cells were cultured in Roswell Park Memorial Institute-1640 (RPMI-1640; Biosun, Shanghai, China) added with 10% fetal bovine serum (FBS; Biosun) and 1% penicillin/streptomycin (Phygene, Fuzhou, China) at 37°C in a 5% CO2 condition.
+ Open protocol
+ Expand
3

Culturing Esophageal Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The esophageal cancer cell lines Eca109, TE1, KYSE30, YES2, EC9706, KYSE170 and KYSE150 were obtained from Procell Life Science&Technology Co. (Wuhan, China). Eca109, YES2, EC9706, KYSE170 and KYSE150 were cultured in DMEM medium (GIBCO, USA) containing 10% fetal bovine serum (FBS; Biological Industries, Beit-Haemek, Israel) and 1% penicillin-streptomycin (Solarbio, China) with 5% CO2 at 37 °C in a humidified incubator. TE1 and KYSE30 cells were cultured in 1640 medium (GIBCO, USA) containing 10% FBS and 1% penicillin-streptomycin with 5% CO2 at 37 °C in a humidified incubator.
+ Open protocol
+ Expand
4

Treg Cell Adhesion to Lymphatic Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The adhesion capacity of Treg cells were characterized as previously described.20 (link) Briefly, primary human LECs (CP-H026, Procell) were seeded in a 96-well flat bottom plate (3598, Corning) at a density of 0.1 million cells per cell. Upon reaching 80% confluence, the cells were treated with 0.22 µm-filtered supernatant from the human ESCC cell line (KYSE-150, Procell) for 10 hours. Subsequently, cells isolated from tumor and tumor-adjacent tissue were resuspended in T cell medium containing 50 units/ml of hIL-2 (200–02, PEPROTECH) and 0.5 million cells were added into each well containing the treated LECs. The co-culture was maintained for 5 hours then flipped the plate, followed by trypsinization into a single-cell suspension. Flow cytometry analysis was performed before and after the co-culture to assess the percentages of three Treg cell subsets.
+ Open protocol
+ Expand
5

ESCC Samples and Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Thirty‐one cases of ESCC samples and paired normal samples were obtained from the First Affiliated Hospital of Zhengzhou University, which was approved by the Research and Ethics Committee of Zhengzhou University. Human ESCC cell lines including Eca109 and KYSE450 and normal oesophageal epithelial cell Het‐1A were purchased from Qingqi Biotechnology Development Co., Ltd (Shanghai, China), and ESCC cell KYSE150 was purchased from Procell Life Science & Technology Co., Ltd (Wuhan, China). The above cell lines were cultured in RPMI 1640 medium supplemented with 10% FBS and double antibiotics including Penicillin and Streptomycin. These cells were placed in an incubator with 5% CO2 at 37°C.
+ Open protocol
+ Expand
6

RT-qPCR and Protein Analysis of ZPR1 in ESCC

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human ESCC cell lines KYSE150, Eca109, TE1, and the normal esophageal cell line HEEC, obtained from Procell Life Science & Technology Co., Ltd, were maintained in a 5% CO2 incubator at 37°C in T25 culture flasks.
The total RNA was extracted using TRIzol (LEAGENE) from cell lines in the logarithmic growth phase and in good growth condition, and was inverted into cDNA using the RevertAid First Strand cDNA Synthesis Kits (Novoprotein). Gene‐specific primers used for RT‐qPCR were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primers for ZPR1 were 5′‐CGC CTCCT GCTC ACCA AGATTC‐3′ (forward) and 5′‐CCGACTGGATCTC CGTGTTGTTC‐3′ (reverse), and for GAPDH were 5′‐CGGAGTCAACGGATTTGGTCGTAT‐3′ (forward) and 5′‐AGCCT TCTCCATG GTGGTGAAGAC‐3′ (reverse). The total proteins were extracted using RIPA lysis buffer and PMSF protease inhibitor (Solarbio), and the bicinchoninic acid (Dingguo) method was used to determine the concentration of total proteins, and then equal amounts of protein were loaded and separated using SDS‐PAGE.
+ Open protocol
+ Expand
7

Culturing Esophageal Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The esophageal cancer cell lines KYSE30, KYSE150, ECA109, and normal esophageal epithelial cell line HET1A were purchased from Procell Life Science & Technology Co., Ltd (Wuhan, China). All cell lines were cultured according to the manufacturer's instructions.
+ Open protocol
+ Expand
8

Esophageal Cancer Cell Line Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Normal human esophagus epithelial cell line Het-1A (IM-H274, Immocell Biotechnology Co.,Ltd., Xiamen, China) and human ESCA cell line TE-1 (CL-0231, Procell Science&Technology Co.,Ltd., Wuhan, China), KYSE30 (CL-0577, Procell), KYSE-150 (CL-0638, Procell) were cultured in RPMI-1640 medium (Gibco, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS, Gibco, USA), supplemented with 100 U/mL streptomycin and penicillin. Cells were lysed with RIPA buffer (Cell Signaling Technology, Danvers, MA, USA). The equal amounts of proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA, USA). The membranes were blocked with 5% non-fat milk for one hour at room temperature. The membranes were incubated with antibody against BIN3 (TA502145, 1:2000, OriGene Technologies, Wuxi, China), E-cadherin (ab1416, 1:1000, Abcam, Cambridge, UK), N-cadherin (ab76011, 1:5000, Abcam) overnight at 4°C. The membranes were incubated with corresponding secondary antibodies.
+ Open protocol
+ Expand
9

Culturing Human Esophageal Squamous Cell Carcinoma Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human ESCC cell lines TE‐1 (RRID:CVCL_1759), KYSE‐30 (RRID:CVCL_1351), KYSE‐150 (RRID:CVCL_1348), and KYSE‐170 (RRID:CVCL_1358) were purchased from Procell Life Science & Technology Co., Ltd (Wuhan, China) and stored in our laboratory. These cell lines have been authenticated in the past 3 years using short tandem repeat analysis. TE‐1, KYSE‐30, and KYSE‐150 cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium, whereas KYSE‐170 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat‐inactivated FBS (GIBCO, Thornton, NSW, Australia) in a 37 °C sterile incubator with 5% CO2. In this study, the cells used in all experiments were mycoplasma‐free.
+ Open protocol
+ Expand
10

Esophageal Cancer Cell Lines Investigation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Four kinds of human esophageal cancer cells inculding TE1, KYSE30, KYSE150 and KYSE170 were chosen to study, which were purchased from Procell Life Science&Technology Co., Ltd. (Wuhan, Hubei, China). There are no mycoplasma contamination among them. All cell lines were culture with RPMI1640 medium (GIBCO, USA) containing with 10% fetal bovine serum (FBS), 100 U/ml of penicillin and 100 μg/ml streptomycin, which were maintained at 37 °C in a humidified atmosphere of 5% CO2. For drug treatment, cells were cultured with or without 10 ng/mL recombinant human RANTES (CCL5) (Peprotech, USA) in medium. For transfection, siRNAs were supplied by Guangzhou RiboBio Co.,Lid.( Guangzhou, China). The hsa_circ_0060927 sequence was cloned into the pLC5-ciR vector and synthesized by Geneseed Biotech Co.( Guangzhou, China). According to the manufacturer’s instruction, ESCC cells inoculated in 6-well cell plates (1 × 106) were transfected with pLC5-ciR vector or siRNA by using FuGENE HD transfection Reagent (Promega, USA) or HiperFect transfection Reagent (Promega, USA). 6 h later, the complete medium was used to instead of the transfection medium. After a further culture for 48 h, the cells were collected.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!