Murine leukemia virus reverse transcriptase

Total RNA was isolated using TRIzol reagent (Invitrogen). First-strand cDNA from total RNA was synthesized using murine leukemia virus reverse transcriptase (Promega) and quantitative reverse transcription PCR (qRT-PCR) was performed with SYBR green kit (Takara) following the manufacturer’s instructions.

Preliminary experiments to evaluate the gene expression of different metalloproteases (MMPs) in NCI-H295R, MUC-1, and TVBF-7 cell lines were performed using the Human Tumor Metastasis RT2 Profiler PCR Array (Qiagen, Milan, Italy). RNA isolation, treatment with DNase, and RNA purification were performed using the Qiagen kit (Qiagen, Milan, Italy). For cDNA synthesis, the RT2 First-Strand Kit (Qiagen, Milan, Italy) was used. PCR was performed with VIIA7 (Applied Biosystems, Monza, Italy) using RT2 SYBR Green qPCR Mastermix (Qiagen, Milan, Italy) as the fluorochrome.
For the other gene expression analysis, total RNA was extracted from cells using the RNeasy kit (Qiagen, Milan, Italy), and 1 µg was transcribed into cDNA, using murine leukemia virus reverse transcriptase (Promega, Milan, Italy). Gene expression was evaluated by q-RT-PCR (VIIA7, Applied Biosystems, Monza, Italy) using SYBR Green as the fluorochrome. Specific primers for MMP2, TIMP1, and TIMP2 were as follows: MMP2 (F: 5′–ACGACCGCGACAAGAAGTAT–3′ and R: 5′–ATTTGTTGCCCAGGAAAGTG–3′), TIMP1 (F: 5′–GGGACACCAGAAGTCAACCA–3′ and R: 5′–GGCTTGGAACCCTTTATACATC–3′), and TIMP2 (F: 5′–AAGCGGTCAGTGAGAAGGAA–3′ and R: 5′–TCTCAGGCCCTTTGAACATC–3′). Expression levels were normalized to the β-actin mRNA level of each sample, obtained from parallel assays.

Total RNA was extracted from cells by RNAeasy kit (Qiagen, Milano, MI, Italy), and 1 μg was transcribed into cDNA using murine leukemia virus reverse transcriptase (Promega Italia, Milano, MI, Italy). Gene expression was evaluated by qRT-PCR (ViiA7, Applied Biosystems, Milano, Italy) using SYBRGreen as fluorochrome, as already described [45 (link)]. Sequences of oligonucleotide primers used were reported in Table 3.
Reactions were performed under the following conditions: 1 cycle at 95 °C for 10 min, 40 cycles at 95 °C for 15 s, 62 °C for 1 min. Differences of the threshold cycle (Ct) values between the β-actin housekeeping gene and the gene of interest (ΔCt) were then calculated as an indicator of difference in the amount of mRNA expressed [46 (link)].

C17.2α neural cells, expressing TRα1 (Chatonnet et al., 2013 (link)), were seeded in 6-wells plates (3.10⁵ cells/well). T3 and the tested compounds were added in the medium on the next day. DMSO was used in control cells to keep solvent concentration constant. Cells were lysed 24h after chemical exposure and RNA extracted using a Macherey-Nagel NucleoSpin RNA II kit. RNA concentrations were measured with a Nanodrop spectrophotometer (Thermo Fisher Scientific). Each RNA sample was reverse transcribed using murine leukemia virus reverse transcriptase (Promega) and random DNA hexamer primers. Quantitative PCR was performed according to a standard protocol, using the Biorad iQ SYBRGreen kit and the CFX96 thermocycler (Biorad). Hprt, a housekeeping gene, was used as an internal control. For each pair of primers a standard curve was established and PCR efficiency was controlled to be within usable range (90%–110%) before analysis using the 2^−ΔΔ(Ct) method (Livak and Schmittgen, 2001 (link)).

The total RNA was isolated from SH-SY5Y and SK-N-SH neuroblastoma cells using the RNeasy kit (Qiagen) and digested with the RNase-Free DNase set (Qiagen), according to the manufacturer’s protocol. RNA was retrotranscribed using murine leukemia virus reverse transcriptase (Promega Italia) and oligo (dT) 15-18 as a primer. Quantitative RT-PCR (qRT-PCR) was performed by the SYBR Green I system (BioRad Italy) and detection were performed with the ViiA7™ RT-PCR System (Applied Biosystems). Primers and complete protocol are indicated in Supplementary Materials and Methods.

Adv-vectors (KLF4, PDGFRA and NAMPT) were used to overexpress target genes, and sh-RNAs (KLF4, PDGFRA and NAMPT) were used to knock down target genes. All were purchased from Viogene Bio. (Jinan, Shandong, China). The KLF4 luciferase reporter plasmid (pGL4-KLF4) was purchased from Yeasen Bio. (Shanghai, China). A fluorescent dual luciferase reporting system and murine leukemia virus reverse transcriptase were obtained from Promega Co. (Mannheim, Germany). The SA-β-gal-kit was obtained from Beyotime (Haimen, China). The MitoSOX Mitochondrial Superoxide Indicator was obtained from Yeasen (Shanghai, China). The anti-p21 antibody was obtained from HUABIO (Hangzhou, China). The anti-PDGF-BB, anti-PDGFRA, anti-PDGFRB, anti-KLF4, anti-NAMPT, anti-PAI-2, anti-uPA and anti-β-actin antibodies and secondary antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA). Other reagents were purchased from Sigma (St. Louis, MO, USA).