Hotstar master mix

The hotspot regions of the oncogenes EGFR (exons 18, 19, 20 and 21) and KRAS (codons 12/13) were analyzed by polymerase chain reaction (PCR), followed by direct sequencing, as previously described [17 (link)]. Briefly, PCR was performed in a final volume of 15 μl, with 50 ng of DNA and 10 μM of forward and reverse primers, using 7.5 μl of the HotStar master mix (Qiagen, Hilden, Germany) according to the protocol proposed by the manufacturer, with the following cycling parameters: 96 °C for 15 min, followed by 40 cycles of 96 °C for 45 s, 58 °C for 45 s (EGFR) or 56.5 °C for 45 s (KRAS), 72 °C for 45 s and 72 °C for 10 min in a thermocycler (Veriti, Applied Biosystems, Carlsbad, USA). Primer sequences were previously described [15 (link)]. The PCR products were evaluated by electrophoresis in agarose gel and further purified using ExoSAP-it (Affymetrix), followed by cycle sequencing carried out using a BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA) with an initial denaturation at 97 °C for 3 min, followed by 28 cycles of 96 °C for 10 s, 50 °C for 5 s, and 60 °C for 4 min. Sequencing products were purified using BigDye Xterminator (Applied Biosystems) and analyzed on a 3500 DNA Analyzer with a ABI capillary electrophoresis system (Applied Biosystems). Sequences were analyzed using the SeqScape software package (Applied Biosystems).

DNA was extracted from urine, breast milk and vaginal and saliva swabs using an EZ1 DSP virus kit (Qiagen, Hilden, Germany), and from blood using a QIAmp DNA mini kit (Qiagen). HCMV DNA was quantified using an Artus CMV RG PCR kit (Qiagen). Four of the seven gB genotypes (gB1-4) and the two gH genotypes (gH1-2) were genotyped by PCR [15 (link)]. Genotyping of gB (gB1, gB2, gB3, and gB4) and gH (gH1 and gH2) was performed using two multiplex real-time PCR assays. Primers and probes specific for each genotype were designed at the N terminus of gB and gH except for gB3, for which the cleavage region was amplified. However, in this study gB2 and gB3 were considered collectively as gB2/3. Genotypes gB5-7 are not detectable by this PCR assay. The primer and probe sequences were as described previously [15 (link)]. Each multiplex assay contained 10 µL DNA extract, 25 µL HotStar Master mix (Qiagen, Hilden, Germany), 0.3 µM primers, 0.2 µM probes, and 4.5 mM MgCl₂. Template denaturation and activation of HotStarTaq DNA polymerase were achieved by heating for 15 min at 95°C. This was followed by 45 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72 °C for 30 s. The assay was carried out in a Rotor-Gene Q 5PLEX instrument (Qiagen, Hilden, Germany).

A mutation analysis was performed using previously described primers [45 (link)]. The PCR assay was performed in a final volume of 15 µL, with 50ng of DNA and 10µM of forward and reverse primers, using 7.5 µL of the HotStar master mix (Qiagen, Hilden, Germany) following the protocol proposed by the manufacturer, with the cycling parameters: 96 °C for 15 min, followed by 40 cycles of 96 °C for 45 s, 56.5 °C for 45 s, 72 °C for 45 s and 72 °C for 10 min were carried out in a thermal cycler (Veriti, Applied Biosystems, Carlsbad, USA). PCR products were purified with EXOSAP (Affymetrix, Santa Clara, CA, USA) and subjected to direct sequencing using a BigDye Terminator cycle sequencing and BigDye X Terminator purification kit (Applied Biosystems). The analysis was performed with the software Genetic Analyzer ABI PRISM 3500 and SeqScape version 2.7 (Applied Biosystems).

DNA extraction was performed by boiling S. aureus pellets in 300 µl of TE buffer as described previously [20 (link)]. Detection of 310 bp fragment of mecA was performed using primer pairs: 5′-GTAGAAATGACTGAACGTCCGATAA-3′ and
5′ CCAATTCCACATTGTTTCGGTCTAA −3′ as described previously [21 (link)]. The reaction mixture contained 12.5 µl of hot star master mix (Qiagen, Hilden, Germany), 0.5 µl each of the forward and reverse primers, 9 µl of molecular grade water and 2.5 µl of the template with a final volume of 25 µl. Amplification was carried out with 40 cycles of initial heat activation at 95 °C for 15 min, denaturation at 94 °C for 30 s, followed by annealing at 52 °C for 45 s, extension at 72^°C for 1 min, and final extension at 72^°C for 10 min. The PCR products were analysed by electrophoresis on a 2 % agarose gel.

Hotspot regions of EGFR (exons 18, 19, 20 and 21), KRAS (codons 12, 13 and 61) and NRAS (codons 12 and 13) were previously reported by our group for the present cell lines [21 (link)]. Sequencing of BRAF exon 15 (codon 660), PIK3CA (exon 9, 21 and 22), and PTEN (exon 1-9) genes was performed as described [43 (link), 44 (link)] [45 (link)]. Briefly, PCR was carried out in a final volume of 15 μl containing 50 ng DNA, 10 μM forward and reverse primers and 7.5 μl HotStar master mix (Qiagen, Hilden, Germany) according to the manufacturer's specifications. Thermal cycling parameters used were an initial denaturation at 96°C for 15 minutes, followed by 40 cycles of 96°C for 45 seconds and 55.5°C for 45 seconds for BRAF, 55.5°C for 45 seconds for PIK3CA and finally, 52°C for 45 seconds for PTEN. For all genes, we used a final extension at 72°C for 10 minutes using a Veriti® 96-Wll Thermal Cycler (Applied Biosystems, Carlsbad, USA). PCR products were purified using EXOSAP-IT (Affymetrix, USB), followed by direct sequencing using an ABI PRISM BigDye XTerminator in conjunction with BigDye XTerminator purification kit (Applied Biosystems). The analyses were performed using the Genetic Analyzer ABI PRISM 3500 and SeqScape version 2.7 software (Applied Biosystems).