Prism 7700

Total RNA was extracted according to the previous protocol with minor modifications^{27 (link), 28 (link)}. Real-time PCR was performed following manufacturer’s instructions using an ABI Prism 7700 with SYBR green I as a double-stranded DNA-specific dye (PE-Applied Biosystems, Cheshire, UK). Primers of IL-8, TNF-α, MCP-1, and hMMP7 were listed in Table 1 and were constructed to be compatible with a single RT-PCR thermal profile (95 °C for 10 min, 40 cycles at 95 °C for 30 s, and 60 °C for 1 min). The accumulation of the PCR product was recorded in real time (PE-Applied Biosystems). In addition, the TaqMan gene expression assays were used to measure GRO-α (Hs00236937_m1, Applied Biosystems) and SPP1 (Hs00959010_m1, Applied Biosystems) mRNA expression. The results of the mRNA levels for the different genes are displayed as transcript levels of the analyzed genes relative to GAPDH. The statistical analyses were performed with Student’s t test. Statistically significant were considered as p-values of ≤0.05.

MeV RNA in PBMCs, LN, BM, BAL, and nasopharyngeal samples was quantified by qRT-PCR as previously described^{1 (link),22 (link),49 (link)}. Briefly, RNA was isolated from 2 × 10⁶ PBMCs, BM cells or LN cells; 10⁶ BAL cells, and nasopharyngeal swab cell pellets. The MeV N gene was amplified (Applied Biosystems Prism 7700) using a one-step RT-PCR kit with TaqMan primers (MVN Forward: 5′-GGGTACCATCCTAGCCCAAATT-3′; MVN Reverse: 5′-CGAATCAGCTGCCGTGTCT-3′) and probe (5′-CTCGCAAAGGCGGTTACGGCC). Controls included GAPDH amplification (Applied Biosystems) and no template controls. Copy number was determined by construction of a standard curve from 10⁰ to 10⁸ copies of RNA synthesized by in vitro transcription from a plasmid encoding the Edmonston MeV N gene (MV41 5′-CATTACATCAGGATCCGG-3′; MV42 5′-GTATTGGTCCGCCTCATC-3′). Data were normalized to the GAPDH control and expressed as [(copies of MeV N RNA)/(copies of GAPDH RNA)] × 5E10.

mRNA expression levels were quantified by real‐time RT–PCR using SYBR Green on an Applied Biosystems PRISM 7700 machine. Data were analysed using the comparative Ct method and normalized by β‐actin levels. Primer sequences were (forward, reverse): Anf, atrial natriuretic factor: ATTGGAGCCCACAGTGGACTA, CCTTTTCCTCCTTGGCTGTTATC; P1np, type I procollagen: CCTCAGGGTATTGCTGGACAAC, TTGATCCAGAAGGACCTTGTTTG; P3np, type III procollagen: AGGAGCCAGTGGCCATAATG, TGACCATCTGATCCAGGGTTTC; Fn, fibronectin: CCGGTGGCTGTCAGTCAGA, CCGTTCCCACTGCTGATTTATC; Tnf‐α, tumour necrosis factor α: GTTCTATGGCCCAGACCCTCA, TCCACTTGGTGGTTTGCTACG; Il‐6, interleukin‐6: GAAAAGAGTTGTGCAATGGCAAT, TTGGTAGCATCCATCATTTCTTTG.

Total RNA was extracted following the TRIzol reagent (Thermo Fisher Scientific) protocol. hERG1 mRNA was quantified by quantitative real-time polymerase chain reaction (qRT-PCR), using the PRISM 7700 sequence detection system (Applied Biosystems) and the SYBR Green PCR Master Mix Kit (Applied Biosystems) as in the study of Iorio et al (2022) (link). The relative expression of hERG1 was calculated by 2ˆ(–delta δ CT) method (Livak & Schmittgen, 2001 (link)). GAPDH housekeeping gene was used as standard reference.
Primers used were the following: GAPDH-F: 5′-AGACAGCCGCATCTTCTTGT-3′; GAPDH-R: 5′-CTTGCCGTGGGTAGAGTCAT-3′; hERG1-F 5′-ACGTCTCTCCCAACACCAAC-3′; hERG1-R 5′-GAGTACAGCCGCTGGATGAT-3′

Gene specific exon-exon boundary PCR products (TaqMan gene expression assays, Applied Biosystems) are measured by means of a PE Applied Biosystems PRISM 7700 sequence detection system during 40 cycles. GAPDH mRNA is used for normalization and relative quantification of gene expression is performed according to the ∆∆Ct method. Expression levels are represented in arbitrary units calculated as a relative-fold increase compared to the control sample arbitrarily set to 1. Quantitative RT-PCRs are repeated in triplicates from at least three independent experiments. The primers used are reported in Table 1.

Total RNA was extracted from liver tissues by Trizol and complementary DNA (cDNA) was synthesized using a cDNA Reverse Transcription kit (code no. RR047A, TAKARA). Quantitative PCR was performed using the SYBR Green PCR mix (code no. RR820L, TAKARA) on a PRISM 7700 (Applied Biosystems). The specificity of the primers used (Table S2) was previously confirmed^{54 (link),55 (link)}.